Post date: Mar 22, 2016 1:55:43 AM
We are extracting Lycaeides DNA from 8 new plates. These are samples from our focal populations for the contemporary evolution/fluctuating selection project. Megan is dissecting the butterflies and I am doing the rest of the extraction. As usual, we are using Qiagen's DNeasy 96 Blood and Tissue kit. I am then preparing GBS libraries using our standard approach. Fragments between 300 and 450 bp were size selected on the BluePippin (this is the same range we used for the last bunch of Lycaeides data) Here are the dates and plates.
Note, I ran out of primers after the first two plates and had Chris send me some. When I arrived at USU I changed the phosphorothioation of the primers. Tthe difference in phosphorothioation, i.e.,
my current version:
Illumina_pcr-1 = 5' A*ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3'
versus the old version:
Illumina_pcr-1 = 5' A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'
appears to matter. You get more of what appears to be primer dimers or something small with the old version, whereas my current version gives a cleaner smear on the gel (see image, first two our my current primers, others are CCN's). I think this is because the * on the 3' end reduces 3->5 exonuclease degradation of the primers by the iproof polymerase.
Here are the BluePippin results, which also suggest that my new primers are better.