Finding the good plasmid

Post date: Dec 02, 2020 9:39:5 PM

PCR tollkit plasmid library: https://docs.google.com/spreadsheets/d/1nG2Gh-mDTx98bymoWK8FctJt_SoQXtbg40ResU_-9fw/edit#gid=0

I have primers targetting LYS2 (where the mutation is in the Small clusters).

These primers also seem to be made to amplify Cherry, a red fluorescent protein.

In the plamid list: https://docs.google.com/spreadsheets/d/13GQVGCIU-aUaMRZL0kLnSxez4JlZoONPnW4j4T84Fho/edit#gid=0

Let's find a plasmid that can be amplified with the following primers, from this list: https://docs.google.com/spreadsheets/d/148FvrjCj-1f55C_Fb7nE9eCnBTBPe0Y4eHLA0pWowOQ/edit#gid=262409300

I also need the plasmid to be resistant to another drug than NAT (the small clusters are resistant to NAT).

forward - F-lys2mCherryHyg - AACTGCTAATTATAGAGAGATATCACAGAGTTACTCACTAATGGTGAGCAAGGGCGAGGAG

reverse - R-lys2mCherryHyg - TAATTATTGTACATGGACATATCATACGTAATGCTCAACCGCGTTAGTATCGAATCGACAG

Additional notes on these primers:

anneals at 71 °C - tested, works -p169/p170

This region:

ATGGTGAGCAAGGGCGAGGAG (highlighted in red above) should match a region in plasmid.

Let's download the maps on the plasmids we have in the lab and that could be interesting for my project, and check if these primers match a sequence in the plasmid.

Resistance againt Hygromycine: hygromycine B phosphotransferase: HBP

1 - pFA6-hphNT1 - alias pFA6a-mCherry-hphNT1 - vector for C-terminal tagging of yeast genes with mCherry and hygromycin selection marker

FORWARD --> ATGGTGAGCAAGGGCGAGGAG matches right the beginning of the Cherry sequence

weirdly there is no match with the reverse primer - maybe the plasmid does not have the sequence the primer is looking for.

SO: from here, I can find primers that match a plasmid, or a plasmid that match my primers

FINDING OTHER PLASMIDS

2 - pYM16 does not have a fluorescent protein

primers 11 and 12:

match a decent sequence comprising Cherry and HYG in pFA6-hphNT1 (label 2).

SO: primers #11 and #12 should amplify plasmid #2.

If not enough plasmid in the box, need to amplify it.