TAAR1 Expression Booster Strategies

TAAR1 Expression Booster Strategies

Stuff we might be able to do to help TAAR1

• https://www.ncbi.nlm.nih.gov/pubmed/18524885

Shows that the addition of an asparagine-linked glycosylation site to the N terminus of the human trace amine associated receptor 1 (TAAR1) is sufficient to enable its plasma membrane expression.

For the GFP-negative construct, the GFP moiety was removed from the above construct by PCR amplification using 5′ T7 promoter sequence primer upstream of triple-HA sequence and 3′ primer containing a stop codon followed by the restriction enzyme site of XbaI. The PCR product was then digested with HindIII (upstream of triple HA sequence) and XbaI, and subcloned into the pcDNA3 vector. Two complementary sequences encoding the EcoRV/EcoRI-digested β2N9 DNA fragment were allowed to anneal in buffer containing 10 mM Tris-EDTA, pH 8.0, and 50 mM NaCl and were ligated into EcoRV/EcoRI restriction enzyme sites. The cDNA illustrative of these modifications is shown below; upper case characters correspond to the three triple-HA inserts, and the last segment corresponds to the β2-adrenergic receptor. The corresponding cDNA sequence is: [tccaccatggctagctacccaTACGATGTTCCTGACTATGCGggcTATCCCTATGACGTCCCGGACTATGCAggatccTATCCATATGACGTTCCAGATTACGCCagatctgatatcATGGGGCAACCCGGGAACGGCAGCGCCgaattcATGATGCCCTTTTGCC]. The translated sequence is: (s t m a s Y P Y D V P D Y a g Y P Y D V P D Y a g s Y P Y D V P D Y a r s d i M G Q P G N G S A e f M M P F C).

• https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3005101/

This paper lists a few ways by which the researchers improved TAAR1 expression, as well as possible other helpful papers. Paragraph copied from the paper below.

Several strategies were employed to promote membrane expression of TAAR1 for the purpose of facilitating pharmacological characterization. These included modifying intracellular loops, developing human-rat chimeras (Lindemann and Hoener, 2005; Reese et al.,2007) and co-expressing human TAAR1 with rat G_αs(Wainscott et al., 2007). Barak et al (2008) reported that insertion of the nine-amino-acid proximal portion of the human β2-adrenergic receptor into the N terminus of TAAR1 could stabilizeit at the plasma membrane. These data provided evidence that glycosylation-stabilized expression of the receptor can occur in cells at levels sufficient for characterizing receptor biology and developing reliable in vitro cellular assays.

ATGGGGCAACCCGGGAACGGCAGCGCC