2023-11-08 NOV
GPT-4 Turbo, AI in Medicine Book closing recommendation, dearraying in two steps
Journal Club
GPT-4 Turbo and other OpenAI product upgrades (this Monday!)
Summary: https://openai.com/blog/new-models-and-developer-products-announced-at-devday
Keynote: https://www.youtube.com/live/U9mJuUkhUzk?si=XofmBo_lY6cFcJP5
Workshop: https://www.youtube.com/playlist?list=PLOXw6I10VTv-exVCRuRjbT6bqkfO74rWz
Hackathon
Prompt Functionalization
AI in Medicine Book closing recommendation was to embrace, hands-on, the "stages of grief" (Zak Kohane) that using LLMs will almost always trigger.
Functionalizing Language Models - make sure you wrote at least on GPT function, that you projected a (text) prompt into (numeric) latent space. Listen to your fingers.
In case it helps, an example of a GPT function:
// defining obj+fun for getting human genome sequences from UCSC genome resource
mod = 'https://episphere.github.io/gpt/functions/testFunctions.mjs'
obj = (await import(mod)).fetchUCSC
fun = (await import(mod))[obj.name]
// testing it
seq = await fun({genome:'hg38',
chrom:'chr1',
start:100000,
end:100100
})
// should return
// 'ACTAAGCACACAGAGAATAATGTCTAGAATCTGAGTGCCATGTTATCAAATTGTACTGAGACTCTTGCAGTCACACAGGCTGACATGTAAGCATCGCCAT'
And an example of embedding onto a feature space:
await (await import('https://episphere.github.io/gpt/min.js')).embeddings('hello world')
Dearraying in two steps (Aaron, Praful)
segmentation, griding
...
WebRTC-based Federated Logistic Regression
tested with the IRIS dataset (Praful)
...