GC content

This software computes the GC content and the composition of each DNA (A,C,G,T) Fasta sequence recorded in an unlimited number of files. Files are processed in parallel for high throughput. The buffer size has been increased to read large sequences (1024*1024 bytes).

Sequence 415 ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGC ...

G = 111

T = 71

A = 97

C = 136

Total count = 415

A => 23.37 %

C => 32.77 %

G => 26.74 %

T => 17.10 %

GC => 59.51 %

Manual :

The sofware is written in GO and compiled for linux 64 bits.

1- if not already installed, install Perl free programming language

2- install GNU parallel (GNU Linux only)

4- unzip the software

5- copy Fasta sequences in the "data" directory

6- execute the software by the command : perl parallel_GCC-0.1.pl

Do not forged to make the file GC-content-XXX executable.

7- results are in the "results" directory