Find Fasta max length

When a gene is associated with many sequences lengths (for example 3'UTR), Find Fasta max length will select and measure the Fasta sequence of maximal length associated to that gene.

Find Fasta max length was written in GO and compiled for Linux and Windows 64 bits.

Manual

1- Copy the fasta file(s) in the fasta directory

example :

>3HSAA000010 CA000010

agatgcttttttaaatttaagaataagacacacaaaactctattaaaa

>3HSAA000012 CA000012

agatgcttttttaaatttaagaataagacacacaaaactctattaaaaaaaaaaaagaaa

taaacctctaactcggtcccca

2- Copy the Gene -> reference file(s) in the list directory.

The file must have two columns (gene name and reference) separated by a TAB

example :

A1BG 3HSAA000001

A1BG 3HSAA000002

A1BG 3HSAA000003

A1CF 3HSAA000004

A1CF 3HSAA000005

A1CF 3HSAA000006

3- Execute the software with the command :

./find_Fasta_max_length-014 (Linux)

or double click on the .exe file (windows)

4- The table of gene max lengths is in the table directory

5- The sequences with max lengths are in the results directory

when multiple fasta and list files are given, all the combinations fasta x lists are computed