This software detects G-quadruplex in RNA sequences, calculates the motifs positions and plots the density of the motifs distribution.
Three kinds of motifs are detected :
G2 quadruplex GG*GG*GG*GG where * is 1–7 of any nucleotide sequence.
G3+ quadruplex : at least 3G GGG+ followed by 1–7 of any nucleotide sequence.
G2+ quadruplex : at least 32 GG+ followed by 1–7 of any nucleotide sequence.
The motif patterns used in this software are :
$re = qr/g{2}.{1,7}?g{2}.{1,7}?g{2}.{1,7}?g{2}/ ; # G2 quadruplex
$re = qr/g{3,}.{1,7}?g{3,}.{1,7}?g{3,}.{1,7}?g{3,}/ ; # G3 and more quadruplex
$re = qr/g{2,}.{1,7}?g{2,}.{1,7}?g{2,}.{1,7}?g{2,}/ ; # G2 and more quadruplex
Manual :
Gquadruplex detector is a GNU Linux/Unix software, it should be run on windows by indicating the full path of Rscript on line 239 :
system("Rscript plot_density_01.r $seq $motif $file");
1- if not already installed, install Perl free programming language
2- install R programming language.
3- unzip the software
4- copy your fasta files in the “data” directory :
the sequence id must follow the ">" sign and the sequence must be in lowercase.
example :
>id
acacatttgcttctactatttacaa
gtttatgtttcagcctgagctcttct
The files can contain an unlimited number of fasta sequences.
5- run the software with the command : perl Gquad_detector_0.9.pl
6- result tables are in the results directory
7- density plots are in the svg directory
8- data to plot the density are in the distribution directory