G-quadruplex detector

This software detects G-quadruplex in RNA sequences, calculates the motifs positions and plots the density of the motifs distribution.

Three kinds of motifs are detected :

G2 quadruplex GG*GG*GG*GG where * is 1–7 of any nucleotide sequence.

G3+ quadruplex : at least 3G GGG+ followed by 1–7 of any nucleotide sequence.

G2+ quadruplex : at least 32 GG+ followed by 1–7 of any nucleotide sequence.

The motif patterns used in this software are :

$re = qr/g{2}.{1,7}?g{2}.{1,7}?g{2}.{1,7}?g{2}/ ; # G2 quadruplex

$re = qr/g{3,}.{1,7}?g{3,}.{1,7}?g{3,}.{1,7}?g{3,}/ ; # G3 and more quadruplex

$re = qr/g{2,}.{1,7}?g{2,}.{1,7}?g{2,}.{1,7}?g{2,}/ ; # G2 and more quadruplex

Manual :

Gquadruplex detector is a GNU Linux/Unix software, it should be run on windows by indicating the full path of Rscript on line 239 :

system("Rscript plot_density_01.r $seq $motif $file");

1- if not already installed, install Perl free programming language

2- install R programming language.

3- unzip the software

4- copy your fasta files in the “data” directory :

the sequence id must follow the ">" sign and the sequence must be in lowercase.

example :

>id

acacatttgcttctactatttacaa

gtttatgtttcagcctgagctcttct

The files can contain an unlimited number of fasta sequences.

5- run the software with the command : perl Gquad_detector_0.9.pl

6- result tables are in the results directory

7- density plots are in the svg directory

8- data to plot the density are in the distribution directory