Fasta Max length synonyms
This software selects the gene synonyms with larger Fasta sequences. The result is a Fasta file with the larger sequence/gene. To increase speed the fasta file is loaded into RAM, do not use this software with large fasta file on low memory computers.
Manual :
1- install Perl free programming language and GNU parallel.
2- unzip the software
3- copy your Fasta files in the “fasta” directory.
4- copy the genes => synonyms table in the "list" directory
- first column : gene names
- second column : fasta gene ref including
- separator : TAB
example :
The Fasta file should start by the gene synomym :
example :
>5HSAA120942 BA120942
cgcggcggcagcagcagcagcagcagcgagaggcagaggcggcggcggcggggaggacag
cacggccgaggctgcccagcggcgcctcctccacaccccccgccgcagcagcaccggcga
5- edit config.txt to set the number of CPUs for parallel processing.
6- execute the software by the command : perl Max_synonym_FASTA.pl
7- processed files are in the “results” directory.
8- log files are in the “log” directory.