ERp44-/- CRISPR-KO HeLa cells

Generation of ERp44^-/- HeLa cells by CRISPR-Cas9

(by Andrea Orsi; Nov 2017/Jan 2018)

Design

The following guides where designed with CRISPOR algorithm (http://crispor.tefor.net/crispor.py) to target respectively exon 1 (guide#218) and exon 4 (guide#26) of human ERp44 genomic sequence: #26 TCGGAAGCTTCCTCAAAAAT, #218 ATCTGAGGTCGGGTAAGGAT

In particular, guide #26 is predicted to recruit Cas9 at 199-218 bp from initial ATG, therefore creating a frame shift in correspondence of amino acids 66-73 of immature ERp44 protein (i.e. 37-44 of the mature protein after removal of signal peptide). Guide #218 instead targets nucleotide 21-40 from initial ATG and generates a frame shift around amino acid 7-14 of the immature ERp44 protein (i.e. within the signal peptide sequence).

Molecular Cloning

General cloning protocol form Zhang lab (https://www.addgene.org/crispr/zhang/) was followed to generate CRISPR plasmids for ERp44, using pX459 v2.0 vector (Addgene #62988) as backbone. This vector drives the expression of both desired gRNA and Cas9-GFP. In addition, it contains a Puromycin resistance which can be used to selected transfected cells.

In order to clone the above guiding sequences into pX459v2.0, the following pairs of oligonucleotides (sense and antisense with convenient overhangs) were purchased by Metabion: CACCGTCGGAAGCTTCCTCAAAAAT (gRNA26_sense); AAACATTTTTGAGGAAGCTTCCGAC (gRNA26_antisense); CACCGATCTGAGGTCGGGTAAGGAT(gRNA218_sense); AAACATCCTTACCCGACCTCAGATC(gRNA218antisense).

Complementary oligos were annealed and phosphorylated in T4 ligation buffer with ANZA T4 PNK (ThermoFisher) for 30min at 37°C followed by 5 min at 95°C and a 5°C/min ramp down to 25°C.

PX459v.2 vector was digested with BpiI (ThermoFisher), dephosphorylated with FastAP thermosensitive AP (ThermoFisher) and gel purified. Ligation between phosphorylated annealed oligos and BbsI-digested vector was performed using Quick Ligase (NEB). Plasmids were screened by restriction digestion and sequenced to confirm insertion of the guide RNA.

Generation of ERp44 knock-out cells

HeLa S3 cells harbouring Tetracycline and Mifepristone inducible systems for protein expression (clone TM3)(Bakunts et al, 2017) were transfected with pX459 plasmids either containing gRNA#26 or gRNA#218, using JetPEI reagent (Polyplus). Starting 48 h after transfection cells were incubated for 5 days with 1 µg/mL of Puromycin, then let to recover for 2 days and finally cloned by limiting dilution in 96well plates. Knock-out of ERp44 was confirmed by western blot, first on the non-clonal population, and later for the single clones. Further western blot and immuno-fluorescence analyses also allowed to distinguish between knock-out (ERp44^-/-), heterozygous (ERp44^+/-) and homozygous (ERp44^+/+) cell lines. Two clones for each genotype were picked and further characterised, namely:

- clones 26-A3 and 218-A3 (+/+)

- clones 218-A1 and 218-A2 (+/-)

- clones 26-A3 and 218-B1 (-/-)

Clone 218-B1 (-/-) has been used later as the parental line for reconstitution with tagged and mutant ERp44 of various types.