created by jonn
on 2019-01-29
This page details the specification of the annotations that Funcotator can create.
Detailed information on Funcotator can be found in this forum post.
The pre-packaged data sources will create a set of baseline, or default annotations for an input data set. Most of these data sources copy and paste values from their source files into the output of Funcotator to create annotations. In this sense they are trivial data sources.
Funcotator performs some processing on the input data to create the Gencode annotations. Gencode is currently required, so Funcotator will create these annotations for all input variants.
The order and a specification of the Gencode annotations that Funcotator creates is as follows:
1. hugoSymbol Type: String The name of the gene in which the annotated variant allele occurs. If the variant allele occurs outside of any known gene boundaries, then this field is set to "Unknown".
2. ncbiBuild Type: String The reference which was used to create this Gencode annotation. Current valid values are: hg19
or hg38
.
3. chromosome Type: String The contig in which the variant occurs. Will always correspond to the contig in the variant position.
4. start Type: Integer The start position in genomic coordinates of the variant allele being annotated (1-based, inclusive). Will always correspond to the start in the variant position.
5. end Type: Integer The end position in genomic coordinates of the variant allele being annotated (1-based, inclusive). Will always correspond to the position last base in the variant allele.
6. variantClassification Type: String The classification of the variant being annotated. Will always be one of the following:
COULD_NOT_DETERMINE
Variant classification could not be determined.INTRON
Variant lies between exons within the bounds of the chosen transcript. Only valid for Introns.FIVE_PRIME_UTR
Variant is on the 5'UTR for the chosen transcript. Only valid for UTRs.THREE_PRIME_UTR
Variant is on the 3'UTR for the chosen transcript Only valid for UTRs.IGR
Intergenic region. Does not overlap any transcript. Only valid for IGRs.FIVE_PRIME_FLANK
The variant is upstream of the chosen transcript Only valid for IGRs.THREE_PRIME_FLANK
The variant is downstream of the chosen transcript Only valid for IGRs.MISSENSE
The point mutation alters the protein structure by one amino acid. Can occur in Coding regions or Introns.NONSENSE
A premature stop codon is created by the variant. Can occur in Coding regions or Introns.NONSTOP
Variant removes stop codon. Can occur in Coding regions or Introns.SILENT
Variant is in coding region of the chosen transcript, but protein structure is identical. Can occur in Coding regions or Introns.SPLICE_SITE
The variant is within a configurable number of bases of a splice site. See the secondary classification to determine if it lies on the exon or intron side. Can occur in Coding regions or Introns.IN_FRAME_DEL
Deletion that keeps the sequence in frame. Can occur in Coding regions or Introns.IN_FRAME_INS
Insertion that keeps the sequence in frame. Can occur in Coding regions or Introns.FRAME_SHIFT_INS
Insertion that moves the coding sequence out of frame. Can occur in Coding regions or Introns.FRAME_SHIFT_DEL
Deletion that moves the sequence out of frame. Can occur in Coding regions or Introns.START_CODON_SNP
Point mutation that overlaps the start codon. Can occur in Coding regions.START_CODON_INS
Insertion that overlaps the start codon. Can occur in Coding regions.START_CODON_DEL
Deletion that overlaps the start codon. Can occur in Coding regions.DE_NOVO_START_IN_FRAME
New start codon is created by the given variant using the chosen transcript. However, it is in frame relative to the coded protein, meaning that if the coding sequence were extended then the new start codon would be in frame with the existing start and stop codons.DE_NOVO_START_OUT_FRAME
New start codon is created by the given variant using the chosen transcript. However, it is out of frame relative to the coded protein, meaning that if the coding sequence were extended then the new start codon would NOT be in frame with the existing start and stop codons.RNA
Variant lies on one of the RNA transcripts. (special catch-all case)LINCRNA
Variant lies on one of the lincRNAs. (special catch-all case)7. secondaryVariantClassification Type: String Additional variant classification information for variant alleles that have a VariantClassification
of SPLICE_SITE
. For a variant allele with the VariantClassification
of SPLICE_SITE
, this will indicate the specific classification of the variant. For all variants that do not have the VariantClassification
of SPLICE_SITE
, this will be the empty string.
8. variantType Type: String Basic information about the variant allele being annotated. Can be one of: * INS
- The variant allele is some kind of insertion. * DEL
- The variant allele is some kind of deletion. * SNP
- The variant allele is a single nucleotide polymorphism. * DNP
- The variant allele is a di-nucleotide polymorphism. * TNP
- The variant allele is a tri-nucleotide polymorphism. * ONP
- The variant allele is an oligo-nucleotide polymorphism (Synonymous with MNP). * MNP
- The variant allele is a multi-nucleotide polymorphism (Synonymous with ONP). * NA
- The variant allele type cannot be determined.
9. refAllele Type: String The reference allele for the position at which this this variant allele occurs. For insertions, this will be set to -
.
10. tumorSeqAllele1 Type: String Always the same as the reference allele. This field is a hold-over required for MAF annotations. For insertions, this will be set to -
.
11. tumorSeqAllele2 Type: String The variant allele being annotated. This field only includes the bases that are different from the reference. For the input VCF records, this field may slightly differ from the alternate allele reported in the base data for the VariantContext
. For deletions, this will be set to -
.
12. genomeChange Type: String A String summarizing the change resulting from this variant allele within the context of the whole genome sequence. Generally the format of this field is: g.[CONTIG]:[POSITION][BASES CHANGED]
The format of this field slightly varies based on VariantType
:
g.[CONTIG]:[POSITION OF BASE PRIOR TO INSERTION]_[POSITION OF BASE AFTER INSERTION]ins[BASES INSERTED]
E.g.: g.chr19:2018023_2018024insAATCG
This indicates that the bases AATCG were inserted between bases 2018023 and 2018024 on chromosome 19.g.[CONTIG]:[POSITION OF BASE DELETED]del[BASE DELETED]
E.g.: g.chr19:2018023delT
This indicates that the base T was deleted at position 2018023 on chromosome 19. OR g.[CONTIG]:[POSITION OF FIRST BASE DELETED]_[POSITION OF LAST BASE DELETED]del[BASES DELETED]
E.g.: g.chr19:2018023_2018025delTTG
This indicates that the bases TTG were deleted starting at position 2018023 and ending at position 2018025 on chromosome 19.g.[CONTIG]:[POSITION OF BASE ALTERED][REFERENCE BASE]>[ALTERNATE BASE]
E.g.: g.chr19:2018023T>G
This indicates that the base T was changed to G at position 2018023 on chromosome 19.g.[CONTIG]:[POSITION OF FIRST BASE ALTERED]_[POSITION OF LAST BASE ALTERED][REFERENCE BASES]>[ALTERNATE BASES]
E.g.: g.chr19:2018023_2018025TTG>GAT
This indicates that the bases TTG were changed to GAT from position 2018023 to position 2018025 on chromosome 19.13. annotationTranscript Type: String The ID of the transcript chosen for the detailed Gencode annotation reporting. E.g.: ENST00000435064.1
If the variant allele does not occur within the bounds of any transcript (e.g. is of type IGR
), then this field is empty.
14. transcriptStrand Type: String The strand direction associated with the transcript on which this variant allele occurs. Either +
or -
.
15. transcriptExon Type: Integer or Empty The exon number on the transcript in which this variant allele occurs (1-based). Corresponds directly to the Gencode exon number. If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type INTRON
or IGR
), then this field is empty.
16. transcriptPos Type: Integer or Empty Position in the chosen transcript of the variant allele. All positions listed are 1-based and inclusive (meaning that the first base in the transcript starts at position 1). For variant alleles that occur at a single base, the format is simply the position at which that variant occurs in the transcript (e.g. 1294
) For variant alleles spanning multiple bases, the format is: [START]_[END]
E.g.: 1236_1237
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of typeINTRON
or IGR
), then this field is empty.
17. cDnaChange Type: String A String that summarizes the change resulting from this variant allele in the coding sequence for the transcript in which it occurs. Positions in this field are relative to the start of the transcript (1-based, inclusive) unless otherwise noted. Generally the format of this field is: c.[POSITION][BASES CHANGED]
The format of this field slightly varies based on VariantType
, the number of affected bases, and whether the variant allele is a SPLICE_SITE
:
c.[POSITION OF BASE PRIOR TO INSERTION]_[POSITION OF BASE AFTER INSERTION]ins[BASES INSERTED]
E.g.: c.2018_2019insAA
This indicates that the bases AA were inserted between bases 2018 and 2019 in the transcript associated with this variant allele.c.[POSITION OF BASE DELETED]del[BASE DELETED]
E.g.: c2018delT
This indicates that the base T was deleted at position 2018 in the transcript associated with this variant allele.c.[POSITION OF FIRST BASE DELETED]_[POSITION OF LAST BASE DELETED]del[BASES DELETED]
E.g.: c2018_2022delTTCAG
This indicates that the bases TTCAG were deleted from position 2018 to position 2022 in the transcript associated with this variant allele.c.[POSITION OF BASE CHANGED]>[NEW BASE]
E.g.: c.1507T>G
This indicates that the base T was changed to G at position 1507 in the transcript associated with this variant allele.c.[POSITION OF FIRST BASE CHANGED]_[POSITION OF LAST BASE CHANGED]>[NEW BASES]
E.g.: c.12899_12900AG>TA
This indicates that the bases AG were changed to TA from position 12899 to position 12900 in the transcript associated with this variant allele.c.e[EXON NUMBER][+|-][BASES FROM EXON][REF ALLELE]>[ALT ALLELE]
E.g.: c.e81-4TAA>A
This indicates that the bases TAA were changed to A starting four bases before exon 81 in the transcript associated with this variant allele.If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type IGR
), then this field is empty.
18. codonChange Type: String A String that representing the codon-aligned change resulting from this variant allele in the coding sequence for the transcript in which it occurs. Positions in this field are relative to the start of the transcript (1-based, inclusive) and aligned to the coding sequenceunless otherwise noted. Unlike the cDnaChange, the bases reported in the codonChange string will always have a length evenly divisble by 3 (except for frameshifts) and represent what the codons would be if the variant alternate allele were expressed in the reference sequence. Capitalized bases represent the bases changed by the variant alternate allele. Lower-case bases represent reference bases. Generally the format of this field is: c.[POSITION][BASES CHANGED]
The format of this field slightly varies based on VariantType
, the number of affected bases, and whether the variant allele occurs in an Intron:
c.([POSITION OF FIRST BASE IN FIRST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT]-[POSITION OF LAST BASE IN LAST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT][REFERENCE CODONS]>[EXPRESSED CODONS]
E.g.: c.(19-21)ctt>ctCGTt
This indicates that the bases CGT were inserted before the 6th codon (starting at base 19, ending at base 21) in the transcript associated with this variant allele, and the resulting expressed codons would be ctCGTt
.c.([POSITION OF FIRST BASE IN FIRST CODON DELETED]-[POSITION OF LAST BASE IN LAST CODON DELETED][REFERENCE CODONS]del
E.g.: c.(997-999)gcadel
This indicates that the 332nd codon (starting at base 997, ending at base 999) was deleted in the transcript associated with this variant allele, and the deleted codon bases are gca
.c.([POSITION OF FIRST BASE IN FIRST CODON DELETED]-[POSITION OF LAST BASE IN LAST CODON DELETED][REFERENCE CODONS]>[EXPRESSED CODONS]
E.g.: c.(997-1002)gcactc>gtc
This indicates that bases in the 332nd codon (starting at base 997) and 333rd codon (ending at base 1002) were deleted in the transcript associated with this variant allele, and the resulting expressed codon would be gtc.c.([POSITION OF FIRST BASE IN LAST CORRECTLY EXPRESSED/REFERENCE CODON]-[POSITION OF LAST BASE IN LAST CORRECTLY EXPRESSED/REFERENCE CODON][REFERENCE CODONS]fs
E.g.: c.(997-999)gcafs
This indicates that bases just AFTER the 332nd codon (starting at base 997, ending at base 999) were inserted or deleted in the transcript associated with this variant allele resulting in a frame shift, and that the last correctly transcribed codon would be codon 332 (starting at base 997, ending at base 999), gca
.c.([POSITION OF FIRST BASE IN FIRST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT]-[POSITION OF LAST BASE IN LAST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT][REFERENCE CODONS]>[EXPRESSED CODONS]
E.g. 1: c.(39871-39873)cCC>cTT
This indicates that the bases CC
were changed to TT
in the 13290th codon (starting at base 39871, ending at base 39873) in the transcript associated with this variant allele, and the resulting expressed codon would be cTT
. E.g. 2: c.(4-9)ctAAgc>ctGCgc
This indicates that the bases AA
starting in the 2nd codon (starting at base 4) and ending in the 3rd codon (ending at base 9) were changed to GC
in the transcript associated with this variant allele, and the resulting expressed codons would be ctGCgc
.19. proteinChange Type: String A short string representing the predicted amino acid sequence change in the product of the gene transcript in which this variant alternate allele occurs. Positions in this field are relative to the start of the amino acid sequence (1-based, inclusive) resulting from decoding the codons in the transcript in which this variant alternate allele occursunless otherwise noted. Amino acid abbreviations are the standard letters as can be found in this table with the exception of the stop codon, which is represented by *
. It is important to note that the positions and amino acids reported in this string may not directly align to the codons in which the variant alternate allele occurs. This is most often due to the variant occurring in a set of tandem repeats which would cause the amino acid change to be "pushed" to the end of the tandem repeats. For protein change strings in the Mitochondrial contig, the mitochondrial genetic code is used (rather than the standard code). The format of this field takes two forms:
p.[REFERENCE AMINO ACID][POSITION][PREDICTED EXPRESSED AMINO ACID]
E.g. 1: p.V5T
The amino acid at protein position 5 was V
(Valine) in the reference and would become T
(Threonine) with the variant alternate allele expressed. E.g. 2: p.R2R
The amino acid at protein position 2 was R
(Argenine) in the reference and would become R
(Argenine) with the variant alternate allele expressed (no change in amino acid sequence / silent variant classification).p.[FIRST AFFECTED AMINO ACID POSITION]_[LAST AFFECTED AMINO ACID POSITION][REFERENCE AMINO ACIDS]>[PREDICTED EXPRESSED AMINO ACIDS]
E.g.: p.100_101Q*>FL
The amino acid sequence starting at protein position 100 and ending at protein position 101 was Q*
(Glutamine,STOP) in the reference and would become FL
(Phenylalanine,Leucine) with the variant alternate allele expressed.If the variant alternate allele does not occur in a coding region, this field will be empty.
20. gcContent Type: Double Represents the fraction of Guanine and Cytosine bases in a window of a given size around a variant. This window size does not include any bases in the variant alternate allele itself. By default the window size is 200 bases.
21. referenceContext Type: String The strand-correct reference coding sequence in a given window around the reference allele. By default the window size is 10 bases
. E.g. For the reference context around a variant with the reference allele C
on the +
strand:
[REF ALLELE] | v GAACCCACGTCGGTGAGGGCC |________| |________| v v 10 bases 10 bases (window size) (window size)
Strand-correct specifically means that if the strand of this transcript is determined to be -
then the sequence is reverse complemented.
E.g. For the reference context around a variant with the reference allele C
on the -
strand:
[REF ALLELE] | v CACGAAAGTCGTTGCGGATCT |________| |________| v v 10 bases 10 bases (window size) (window size)
22. otherTranscripts Type: String A summary of the other transcripts in which this variant occurs, which were not chosen for detailed reporting due to the transcript selection scheme. Each other transcript is represented by a condensed string that indicates how that transcript would be affected by this variant alternate allele. Each other transcript takes the form: [HUGO SYMBOL]_[TRANSCRIPT ID]_[VARIANT CLASSIFICATION]_[PROTEIN CHANGE STRING]
E.g.: SDF4_ENST00000263741.7_MISSENSE_p.R243Q
If the other transcript does not have a protein change string, then that part is not rendered. In the event that there are multiple other transcripts, these transcripts are separated by /
E.g.: SDF4_ENST00000263741.7_MISSENSE_p.R243Q/TNFRSF4_ENST00000379236.3_FIVE_PRIME_FLANK
If this variant alternate allele occurs in only one transcript, this field will be empty.
Other annotations will follow the Gencode annotations and will be based on the data sources included in the data sources directory.
Updated on 2019-01-30
From yfarjoun on 2019-01-30
I think that there’s a “g” base missing in the second example in section 21.
From jonn on 2019-01-30
Yup – thanks!