Amplicon sequencing using the Illumina GAIIx platform

Overview

The following protocol is designed for using the Illumina GAIIx machine to ampliify and sequence a pool of PCR products generated using Linker-mediated (splinkerette) PCR on tumor samples containing Sleeping Beauty transposons inserted randomly in the mouse genome. The general steps are as follows:

1. DNA Purification: Isolate tumor DNA using standard DNA extraction techniques.
2. 1st DNA digestion: Cut the DNA using a 4 bp cutter that will cut once inside the transposon and once outside.
3. Linker Attachment: Attach linker DNA that is specific for the overhang left from the 4 bp cutter used above.
4. 2nd DNA digestion: Cut the DNA a second time using an enzyme that does not cut within the transposon, but does cut the plasmid vector that was used to create the transposon concatamer transgene construct. This should remove the linkers from any transposons that remain in the concatamer (i.e. donor location).
5. 1° PCR: Perform primary PCR using a primer specific for the transposon and a primer specific for the linker.
6. 2° PCR: Perform secondary PCR using nested versions of the above primers that also have the required fusion sequences (Fusion A and Fusion B) as well as a 10 bp barcode that is unique for each tumor sample processed.
7. Final Dilution: Quantify the DNA from all separate reactions and combine equimolar amounts and mix. Send 100 µl of final mix to be amplified and sequenced.

Materials

• Thin-Wall 96-well PCR plates. Platinum Series Non-skirted, Flat-well PCR Plates (50/pk) GeneMate from ISC cat #: T-3031-21
• 8-strip caps for 96-well plates (125 strips/pk) ISC cat #: T-3031-21c
• MinElute 96 UF PCR Purification plates (4/pk) Qiagen (Ustores) cat # 28051
• Vacuum Manifold from Qiagen
• Nunc non-treated black 96F well plates for reading fluorescence Cat # 237105
• Faststart PCR Master (400 rxn/ 10 ml) Roche (Ustores) cat # 04710444001
• T4 DNA ligase & buffer (100 rxns, 20,000 units @ 2e6 units/ml) NEB Cat # M0202T (Ustores Cat # CX27373)
• Appropriate restriction enzymes, buffers & BSA
  • BamHI (10,000 units @ 20,000 units/ml) NEB Cat # R0136S
  • BfaI (100 units @ 10,000 units/ml) NEB Cat # R0568S
  • NlaIII (500 units @ 10,000 units/ml) NEB Cat # R0125S
• Linkers 100 nmoles each
  • BfaI linker +: 5' GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'
  • BfaI linker-: 5' Phos-TAGTCCCTTAAGCGGAG 3'NH2. Note: This linker is modified with a 5' phosphorylation and 3' amino modifier from IDT (this is NOT the 3' amino modifier C6 dt)
  • NlaII linker+: 5' GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3'
  • NlaII linker-: 5' Phos-GTCCCTTAAGCGGAGCC 3' NH2 Note: This linker is modified with a 5' phosphate and 3' amino modifier from IDT (this is NOT the 3' amino modifier C6 dt)
• PCR primers 25 nmoles for first 2, 100 nmoles for Spl Link1 1, 100 nmoles for 2º reverse primer
  • Spl IRDR R1 1 (NlaIII): 5' GCTTGTGGAAGGCTACTCGAAATGTTTGACCC (Right side)
  • Spl IRDR L1 1 (BfaI): 5' CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC (Left side)
  • Spl Link1 1: 5' GTAATACGACTCACTATAGGGC
  • Linker nested barcoded forward primers (ordered specially)
  • Linker nested reverse primer: 5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC
• DNA extraction kit

Protocol

• 1) DNA Purification: Isolate tumor DNA using standard DNA extraction techniques. We use a technique similar to the Puregene Genomic DNA Purification Kit from Gentra. DNA from approx 50 mg of frozen tissue is resuspended in 50 to 100 µl TE. DNA concentration ranges from 10 to 2000 ng/µl depending on tissue type and starting amount.

• 2) 1st DNA digestion: Cut the DNA using an enzyme that will cut once inside the transposon and once outside (at an unknown, random location). Because the genomic location of the transposon is unknown, the “outside” cut will be at varying distances from the end of the transposon. We actually separate a single tumor sample into two and use one enzyme to isolate the right side of the transposon and another enzyme to isolate the Left side of the transposon. Digest DNA for 3-6 hrs or overnight at 37° C in water bath or incubator.

Left Digest (left side of transposon) - 49.5 µl

Right digest (right side of transposon) - 50 µl

• Notes: BfaI cuts at C-TAG sequences. NlaII cuts at N-CATG sequences. You will need 50 µl of enzyme for 96 reactions. When setting up digest, remember to leave a portion of the water for making the enzyme mix, makes it easier to aliquot. Glycerol should be less than 5% of any digestion solution, if DNA is in glycerol, may have to increase digestion volume.
• Heat inactivate enzymes (BfaI = 80°C for 20 min, NlaIII = 65°C for 20 min)
• Clean up digest using MinElute 96 well plates on a vacuum manifold.
• Place all 50 µl into 96 MinElute 96 well plates
• Place in vacuum manifold and vacuum for about 15 minutes until wells look dry
• Blot bottom of tray with paper towel to remove all liquid
• Add 30 µl H2O to each well, shake on Genie Multi-microplate vibrator set at 10 for 2 min. Or pipette up and down 20 to 40 times.
• Transfer 30 µl from 96 MinElute into clean 96 well plates.
• Note: When I spec the DNA at this point I normally get a concentration of between 10 and 30 ng/µl, sometimes as low as 2 to 10).

• 3) Linker Attachment: Attach linker DNA that is specific for the overhang left from the 4 bp cutter used above

BfaI linker +: 5' GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI linker-: 5' Phos-TAGTCCCTTAAGCGGAG 3'NH2. Note: This linker is modified with a 5' phosphate and 3' amino modifier from IDT (this is NOT the 3' amino modifier C6 dt)

NlaII linker+: 5' GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3'

NlaII linker-: 5' Phos-GTCCCTTAAGCGGAGCC 3' NH2 Note: same as BfaI linker-.

• Dissolve linkers at a stock concentration of 100 µM in water
• Mix 50 µl of linker+ with 50 µl of linker- and add 2 µl of 5M NaCl in a 1.5 ml eppe tube
• Repeat for other set of linkers
• Place in 95° C heat block for 5 min. Then turn off heating block and let slowly cool to room temp (this takes an hour or more).
• Note: If you spec the linker DNA the concentration should be ~950 ng/µl. You will need 580 µl of annealed linkers for 96 reactions.
• Set up ligation reactions and incubate for 4 hrs to overnight at 16°C.

Linker ligation reaction 20 µl

• Note: If you use another ligase, adjust reaction conditions accordingly. NEB uses "cohesive end units" while invitrogen uses Weiss units. 1 weiss unit = 67 coehsive end units. 1 cohesive end unit = 0.015 weiss units. So Invitrogen 1 U/µl = NEB 67 U/µl. .
• Heat inactivate the T4 DNA ligase 65°C for 20 min if using Invitrogen T4 DNA ligase
• Clean up ligation using MinElute 96 well plates and a vacuum manifold.
• Resuspend in 30 µl H2O.
• Note: When I spec the DNA before clean-up, I get a concentration of ~ 1 µg/µl. After clean-up I normally get a concentration of between 50 and 200 ng/µl
• 4) 2nd DNA digestion: Cut the DNA a second time using an enzyme that does not cut within the transposon, but does cut the plasmid vector that was used to create the transposon concatamer transgene construct. This should remove the linkers from any transposons that remain in the concatamer (i.e. donor location).
• Digest DNA using BamHI (both left and right side) for 3-6 hrs or overnight at 37° C in water bath

2° BamHI Digest 50 µl

• Clean up digest using MinElute 96 well plates and a vacuum manifold.
• Resuspend in 30 µl H2O.
• Note: When I spec the DNA I normally get a concentration of between 1 and 10 ng/µl. BamHI cuts at G-GATCC sequences.

• 5) 1° PCR: Perform primary PCR using a primer specific for the transposon and a primer specific for the linker. These will vary depending upon what transposon and linker you are using. The primers below work for the T2/Onc transposon
• Primer 1 (specific for the T2/Onc transposon)
• Spl IRDR R1 1 (NlaIII): GCTTGTGGAAGGCTACTCGAAATGTTTGACCC (Right side)
• Spl IRDR L1 1 (BfaI): CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC (Left side)
• Primer 2 (Works for both left and right)
• Spl Link1 1: GTAATACGACTCACTATAGGGC

Primary PCR

• PCR Program: 94°C for 5 min. 30 cycles of 94°C for 30 sec, 60°C for 30 sec, 72°C for 90 sec. Final extension at 72°C for 5 min.
• Clean up PCR product using MinElute 96 well plates and a vacuum manifold.
• Resuspend in 30 µl H2O.
• Note: When I spec the DNA I normally get a concentration of around 400 ng/µl)
• Make a 1:75 dilution of the 1° PCR by diluting 2 µl into 150 µl H2O
• 6) 2° PCR: Perform secondary PCR using nested versions of the above primers that also have the required for the Illumina GAIIx machine as well as a 12 bp barcode that is unique for each tumor sample processed. See “illumine Primers” worksheet for how these primers were constructed and the plate map for the distinct barcodes.

Secondary PCR

• PCR Program: 94°C for 2 min. 30 cycles of 94°C for 30 sec, 53°C for 45 sec, 72°C for 90 sec. Final extension at 72°C for 5 min.
• Clean up PCR product using MinElute 96 well plates and a vacuum manifold.
• Run 45 µl of PCR reaction on a 1% agarose gel. There should be a smear of product ranging from 100 to 600 bp. Primer dimer should be around 100 bp
• Clean up remaining PCR product using MinElute 96 well plates and a vacuum manifold, wash one time with 50 µl H2O.
• Resuspend in 30 µl TE

• 7) Final Dilution: Quantify the DNA from all separate reactions. This can be done in a 96 well plate (see quantitation protocols) and combine equimolar amounts and mix. Dilute final solution to 10 to 20 ng/µl. Send 20 µl of final mix to be amplified and sequenced.