Note: This protocol originally came from Adam Dupuy. I have made adjustments and changes. Basic procedure is as follows:
Perform linear PCR on undigested genomic DNA using a primer at one end of the transgene (remember that Taq polymerizes in the 5’ → 3’ direction). This will create many (but not millions) of copies of DNA starting within the transgene, but extending beyond into genomic DNA. As the transgene is most likely a concatomer, it will also create many copies of DNA that only include the transgene concatomer. In order to get rid of these, the PCR products will be cleaved with a restriction enzyme that cuts just upstream of the primer binding site. This should cleave all the concatomer products, but leave the end fragment uncleaved.
Linear PCR
Use undigested genomic DNA from transgene positive animal as template.
2 µL DNA (100-200ng) 94˚C 2 minutes
5 µL 10X buffer
2 µL MgSO4 94˚C 15 seconds
1 µL 10 mM dNTPs 65˚C 30 seconds
0.5 µL transgene primer* 68˚C 3 minutes
0.25 µL Platinum Taq with Pfx** repeat for 50 cycles
36.75 µL H2O 68˚C 7 minutes
50.00 µL Total 4˚C
*Primer needs to be biotinylated. Primer should be placed about 100 – 200 bps away from the ends of the transgene to allow for some exonuclease activity that may have removed sequence from the end fragment prior to integration of the transgene concatomer. Ideally the primer should also be downstream of a unique restriction site within the concatomer that will be used later to remove contaminating PCR products from internal concatomer fragments prior to cloning. This enzyme cannot be a blunt cutter and should not cut frequently in genomic DNA. Since the end transposons on the concatomer could be in either direction, it is necessary to use a transgene primer for both directions.
Currently will try using the transgene primer:
Corey (76) IRDR:
**Use a mixture of platinum Taq along with Pfx or Pfu to increase fidelity and longer PCR products. Adam said you don’t even need Taq, but I’ll try a 5:1 Pfx:Taq mixture. Pfx is Invitrogen from Pyrococcus species and results in blunt ends and is “high fidelity”. Pfu turbo is Stratagene from Pyrococcus furiosus and also results in blunt ends and is “high fidelity”. Another option is Vent or Vent(exo-) from Thermoccus litoralis.
Purification of single-stranded PCR products
Clean up PCR reaction to remove unincorporated primers and nucleotides. Use the QIAquick PCR purification kit. Follow instructions
Bind products to magnetic beads using manufacturer’s suggested protocol (Dynabeads® kilobaseBINDERTM Kit).
Collect products bound to beads in 20 µL of dH2O.
Ligation
This ligation adds a single-stranded linker on the 3’end of every single-stranded PCR product.
20 µL DNA (beads)
4 µL 10X buffer
1 µL linker (-) (must have 5’phosphate)
2 µL T4 RNA ligase
13 µL dH2O
40 µL total
Incubate at 37˚C overnight.
Will use the MseI Linker- from Rachel: 5’ Phos – TAG TCC CTT AAG CGG AG C3 spacer 3’. Note: According to Aron, the linker- will also have a 3’ modification that normally blocks DNA polymerase when using it for linker-mediated PCR.
Prior to running PCR, wash products to remove unincorporated primers by collecting beads on magnet. Wash twice with 100 µL dH2O. Resuspend beads in 10 µL dH2O.
PCR
10 µL DNA (beads) 94˚C 2 minutes
5 µL 10X buffer
2 µL MgSO4 94˚C 15 sec
1 µL 10 mM dNTPs 60˚C 30 sec
0.5 µL nested primer 68˚C 3 minutes
0.5 µL linker nested primer repeat for 30 cycles
0.75 µL Platinum Taq with Pfx
30.25 µL H2O 68˚C 7 minutes
50.00 µL Total 4˚C
The linker nested primer is AGG GCT CCG CTT AAG GGA C
(reverse complementary linker nested = GTC CCT TAA GCG GAG CCC T)
I designed the other nested primer to be:
(76)IRDRR1 nested ggattaaatgtcaggaattgtg
Digestion to remove background
Place PCR reaction on magnet. Collect supernatant and discard beads. This will get rid of the primary PCR product and anything attached to the initial biotinylated primers.
Clean up reaction to remove unincorporated primers and nucleotides.
Digest with an enzyme that will specifically cut PCR products that result from amplification of internal concatomer junctions. This enzyme cannot be a blunt cutter and should not cut frequently in genomic DNA.
Currently try to use Asc1, which cuts once within the concatomer and rarely cuts genomic DNA.
Cloning
Clean up the digest using a Qiagen column. Elute in 30 µL dH20.
Set up ligations using the pCR-Blunt (Zero Blunt kit, Invitrogen) cloning vector with high concentration T4 ligase from NEB.
2 µL 10X ligation buffer
5 µL PCR product
1 µL cloning vector
1 µL T4 ligase
11 µL dH2O
20 µL Total
ligate on benchtop for 1-2 hours or overnight at 16˚C
Transform 2.5µL of ligation using the chemically competent TOP10 cells provided with the Zero Blunt cloning kit.
Plate 300 µL of the transformation on 15 cm LB-Kan plates.
* Thaw competent cells on ice (stored at –700C). Aron makes these, they are in the -70º C on the second shelf (see protocol below for preparing CaCl2 competent cells). They are aliquoted in 500 µl samples. Do not reuse, throw away any unused portions
* For each transformation, pipet 100 ul of competent cells into a sterile 14 ml snap cap falcon tube (variation: 1.5 ml eppe). Each tube of competent cells contains enough for 4-5 transformations.
* Add DNA (5-10 ul or 1 µl plasmid) to each sample and incubate on ice for 20-25 mins (can be as short as 5 min). This allows the DNA to adsorb to cell surfaces.
* Heat shock the cells/DNA to allow uptake of DNA into cells. Place tubes in 42º C water bath of 45 seconds. Variation: place all tubes at 370C for 2 mins. Return cells to ice.
* Add 1 ml of LB or SOC to each tube and incubate at 370C for 45-60 mins in the shaking incubator to all the cells to recover from the treatment and start growing again. If the initial transformation was started in an eppendorf tube transfer to a snap cap falcon at this time. Liquid should appear cloudy at this point.
* If you are just growing up plasmids, directly plate about 25 µl on an appropriate anti-biotic resistant agar plate. (If the plasmid confers ampicillin resistance, plate on a Carb or Amp plate, if the plasmid confers Kanamycin resistance, plate on a Kan plate. Rachel makes the plates up and leaves in the walk-in cooler.)
* If you are cloning and want to recover all the cells, transfer the cells to an eppendorf tube at this time and spin the cells briefly to pellet them after recovery.
* Remove supernatant and resuspend in 100 ul of fresh LB or SOC.
* Plate the cells on LB plus antibiotic plates. If more than 1000 colonies are expected, spread a fraction of the sample on one plate and the remainder on a second plate. For example, with a 100 ul sample, spread 10 ul on one plate and 90 ul on a second.
* Incubate the plates overnight (approx. 16 hours) at 370C inverted.
* To proceed with a plasmid mini-prep, prepare a 14 ml snap cap falcon tubes with 1 ml LB media + 1 µl of 60 mg/ml Carb. Pick a single colony using either a toothpick or a pipette tip and place in the falcon tube. Incubate overnight in 37º C shaker. Use entire ml to perform plasmid mini-prep.
If X-gal is required for blue-white selection:
50 ul of 2% X-gal
20 ul of 0.1 M IPTG
Mix together and spread evenly on a plate. Allow plate to dry before spreading transformation.
Agar plates
Purpose:
Prepare agar plates for bacterial colony growth:
25 g LB
15 g Agar
to 1 L H2O
Mix thoroughly. Autoclave (121º C for 15 minutes). Cool to around 55º C (warm to touch).
Add antibiotic.
1 ml Kanamycin (60 mg/ml) or 1 ml Ampicillin or Carbamycin 60 mg/ml
Pour into 60 cm petri dishes, swirl, & cover. Let harden overnight. Store @ 4ºC.
Before plating, add 40 µl X-gal (50 mg/ml in DMSO), spread evenly, let dry in 37ºC incubator.
Plate bacteria.
This method is for batch preparation and frozen storage of competent cells. This is the most convenient method for making competent cells. It’s also the least rigorous and consequently transformation frequencies are relatively low, usually around 10^6 colonies per ug of circular DNA. One can obtain much higher frequencies (10^7-10^9 per ug) by using cells prepared by the Hanahan method or by electroporation. However, for most purposes, like introducing plasmid DNA into cells for stocks or most cloning applications, calcium-treated cells are fine. The higher transformation frequencies are usually needed only for introducing precious library DNA or recovering very rare clones in a mixture.
Note: It is very important that sterile technique be strictly observed through the prep. All centrifuge bottles, tubes, solutions, pipets, etc. must be sterile. Any contamination during the prep will result in problems for everyone in the lab who uses the competent cells for cloning, thereby probably decreasing your popularity.
Inoculate 1mL of LB with cells from a frozen glycerol stock and grow overnight at 370C.
Inoculate 500mL of LB with the entire overnight culture.
Grow at 370C until OD550= 0.45 to 0.6, approx 4 hours. Cells overgrown will have significantly lower transformation efficiency than those in log phase growth.
Harvest cells on ice. Spin for 5k for 5 min at 40C using a JA10 or GS3 rotor. It’s convenient to split the prep into 2 500mL centrifuge bottles at this point.
Resuspend in a total of 250mL of cold 50mM CaCl2.
Incubate on ice for 15 min.
Combine in one 500mL bottle and spin 5k for 5 min at 40C.
Resuspend in 21.5mL of cold 50mM CaCl2.
Add 3.5mL of sterile 100% glycerol. Mix gently.
Aliquot 500uL to 1mL portions into sterile eppendorf tubes on ice.
Flash freeze tubes in liquid nitrogen and store at –700C.
Cell aliquots should be used within 6 months of preparation to ensure transformation frequency.
Set up ligations on ice using the Promega pGEM-T Easy Cloning Kit
Invitrogen buffer/ligase 10 µl
5x Ligation buffer Invitrogen 2 µl
pGEM T Easy TA cloning vector 1 µl
T4 Ligase from invitrogen 1 µl
Purified PCR product 6 µl
Alternatively use
NEB buffer/ligase 10 µl
10x Ligation buffer NEB 1 µl
pGEM T Easy TA cloning vector 1 µl
T4 Ligase from NEB (2e6/ml) 1 µl
Purified PCR product 7 µl
Incubate 2 hours RT
Place on ice.
Electroporation
Set electroporation device to
200 resistance
25 capacitance
1.75 Volts Variations: 2.5 V, 1.8 V
Mix 25 µl DH10B cell with 2.5 µl of ligated PCR product and place in brown-top 0.1 cm gap cuvette. Use minimal pipetting, make sure there are no bubbles on bottom. Note: to avoid arc, can decrease amount of DNA to 2.0 µl (high salt content of DNA can cause arc). Can also use more DH10B cells if necessary.
Place cuvette into electroporation device. Press button until beep or arc (bad). Time constant should be around 4.0 to 4.2, but can be 3.6.
Gently add 500 µl of SOC to cuvette and carefully transfer contents to new bacterial tube. Wash cuvette with an additional 500 µl of SOC and transfer to tube. Incubate 60 min 37º C to allow bacteria to recover. Variation: 5 ml of SOC
Freeze down 4 tubes per sample after adding 20% glycerol (can heat glycerol, transfer to eppe’s, then allow to cool before adding bacteria). Each tube contains 160 µl SOC/bacteria + 40 µl glycerol.
Cloning splinkerette PCR – Plating & picking colonies
Plate 20 µl of recovery on 2 Amp plates with X-gal (40 µl per plate) per sample.
10 µl ligation + 100 µl competent cells
store on ice 15-30 min
heat shock in 37º C water bath for 45 sec
Put on ice
Add 300 µl LB
Shake 37º C for 45 min
Plate about 250 µl on CARB plates + 40 µl X-gal
Pick colonies (~12 per plate)
3 ml of LB and CARB
Sequence the mini-preps.
Protocols for Cloning
Restriction Digests
Depending on scale of reaction DNA amount varies
10x restriction buffer diluted to 1x concentration
100x BSA (if needed) diluted to 1x concentration
enzyme, depends on scale of reaction and DNA concentration
H20 to desired volume
Incubate at enzyme specific temperature 1hr – O/N
CIP (calf intestinal phosphatase), removes 5’ phosphates
Typically 100ul volume
10x CIP buffer or NEB 2,3,4, EcoRI, BamHI, SalI diluted to 1x concentration
Incubate at 37 for 1hr
Phenol extract or gel purify fragment
Klenow reaction
Typically 100ul reaction
10x EcoPol buffer or any NEB buffer (only 50% active)
33uM dNTPs (if needed)
For fill-ins: Incubate at 25 for 15 mins, add EDTA to 10mM to stop rxn and heat to 75 for 10min
Exo rxns: Incubate at 37 for 30 mins, add EDTA to 10mM to stop rxn and heat to 75 for 10min
Ligation Rxns
Best if 5M excess of fragment is used or successive dilutions of fragment to vector made
Fragment
Vector
10x ligation buffer diluted to 1x concentration
1ul enzyme
H20 to 10-15ul total volume
EtOH ppt
Add 1 volume 3M NaOAc to 10 volumes sample
Add 2 volumes EtOH, mix thoroughly
Incubate –20 for 1hr, pellet DNA, dry and resuspend in new buffer or H20
Overview:
a) Using overlapping primers that contain the point mutation, PCR amplify an entire plasmid. This will produce a long PCR product with overlapping ends containing the point mutation of interest.
b) Digest the PCR with DpnI which only cuts Dam-methylated DNA. Dam methylation is a bacterial methylation that cuts methylated GATC, which only occurs in bacterial DNA. This will cut up all remaining plasmid, leaving the PCR product untouched.
c) Transform the PCR product using CaCl2 transformation into DH5alpha cells. This will recircularize the PCR product resulting in the original plasmid, but containing the point mutation.
* Design overlapping primers. Primers should be around 25 to 33 bp in length. Point mutation should be about 3 to 6 bp in from the 5’ end of the primers.
* Run PCR in 50 µl volume using high fidelity polymerase, such as Vent. (Still need to have TA overhangs, so don’t use Pfx. Actually, NEB catalog says that Vent produces up to 95% blunt end fragments and the best way to clone them is in blunt-end cloning procedures). Run 10 µl of PCR product on gel to make sure the product is there at the right size. Clean up remaining PCR reaction and resuspend in small volume.
* Digest PCR product with DpnI. This will get rid of bacterial DNA.
* Transform PCR product into DH5a using CaCl2 transfection. This will recircularize the plasmid. Pick about six colonies, perform a digestion to see if the correct fragments are produced, then sequence those clones to see if sequence is correct.
Digest 1 µg DNA of both recipient plasmid and donor fragment in 40 µl (1 µl enzyme, 4 µl 10x buffer, H2O) overnight.
If doing a double digest:
Add 3 volumes 100% Etoh and put in freezer for 30 minutes
Spin 14,000 rpm 10 min at 4ºC.
Wash with 2 volumes of 70% ethanol, let pellet dry
Resuspend in 40 µl of 1x buffer containing the second enzyme and digest overnight.
Heat inactivate digestion enzyme: 65ºC for 20 minutes
Fill in ends of DNA using the Klenow reaction:
Add 2 µl 10 mM dNTPs
Add 1 µl Klenow fragment
Incubate 20 min RT
Load entire digest on a 0.8% agarose gel to separate fragments. Can also check concentration by running a ladder of known concentration in an adjacent well.
Cut out desired bands and purify using the MolBio PCR gel purification kit, with final resuspension in 20 µl TE
Can spec DNA at this point using the nanophotometer.
Dephosphorylate the ends of the recipient vector plasmid (not the donor fragment) using Calf intestinal phosphatase.
Add 2 µl NEB buffer 3
Add 1 µl CIP
Incubate 1.5 hrs 37ºC
Purify (vector plasmid?) with QiaQuick PCR purification kit and resuspend in 30 µl TE
Ideally want about 100 µg/ml. Calculate concentration in pmole/ml by assuming that 1 bp has a mass of 660 daltons.
Run 5 µl on a 0.8% agarose gel to confirm size and concentration.
Add vector and inserts together (approximately 60 fmoles of each) and ligate using DNA ligase in as small of volume as possible.
1 µl 10x ligation buffer
0.5 U of bacteriophage T4 DNA ligase
1 µl 5 mM ATP (unless buffer already contains
up to 8.5 µl of H2O
1 to 1.5 µl 30% PEG 8000
Incubate overnight at 16ºC. Transform into E. coli.
Preparation
Stable transfections: cut plasmid and purify, so there is enough DNA for all transfections
Day 1)
6 well option) Plate cells in 6 well plates in 2 ml media (can have pen/strep). Plate an amount that will result in approximately 85 to 90% confluence the day of transfection with lipofectamine 2000.
24 well option) Plate cells in a 24 well plates in 500 µl media with no antibiotics. Plate at an amount that will result in approximately 90 to 95% confluence the next day for lipofectamine 2000 or 50% confluence for Lipofectamine LTX.
HT-29 cells plate 1.5 e5 cells/well for 90% confluence
SW480 cells plate 1.2 e5 cells/well for 90% confluence
HCT116 cells plate 8e4 cells/well for 90% confluence, or 6.5 e4 for 50% confluence
DLD1 cells plate 8e4 cells/well for 90% confluence or 6.5 e4 for 50% confluence
Day 2)
Lipofectamine 2000 in 6 well plates
In tube A place 190 µl of Opti-Mem-I and 10 µl Lipofectamine 2000 incubate 5 min RT (not more than 10 min).
In tube B place 2 µg of DNA in Opti-Mem-I to a final volume of 200 µl.
Gently combine tube A and tube B and incubate at least 20 min up to several hours.
Remove media from 6 well plates and add 1.6 ml fresh media (can have pen/strep)
Add the lipofectamine/DNA mixture to 6 well plates, gently swirl to mix.
Incubate 37ºC + CO2 for 4 to 6 hours for delicate cells or overnight for tough cells.
Lipofectamine LTX in 24 well plates
In tube A place 47 µl of Opti-Mem-I and 3 µl Lipofectamine LTX incubate 5 min RT (not more than 10 min).
LTX optimal ratio in 1:3.5 ratio in 24 well plate using 400 ng DNA
Use the Plus reagent at 0.4 µl per well in a 24 well plate
In tube B place 400 ng of DNA in Opti-Mem-I to a final volume of 50 µl.
Gently combine tube A and tube B and incubate at least 20 min up to several hours.
Remove media from 24 well plates and add 400 µl fresh media (can have pen/strep)
Add the lipofectamine/DNA mixture to 24 well plates, gently swirl to mix.
Incubate 37ºC + CO2 for 4 to 6 hours for delicate cells or overnight for tough cells.
Day 3 and on)
Replace with fresh media and allow cells to grow for 1 to 2 days. Check for fluorescence expression if plasmid contains fluorescent marker.
Trypsinize and transfer to 100 mm plate (from 6 well plate) or 6 well plate (from 24 well plate), add selection antibiotic if creating stable lines.
Overview: Start with a 10 cm plate of almost confluent ES cells. Electroporation will probably kill about half the cells and about 2 to 20% of the remaining cells will be successfully transfected. If trying to get stable integration, linearize the plasmid before electroporation.
Three hours before electroporation change media in plates
One hour before electroporation warm media and gather supplies
Prepare four plates for each transfection by coating with gelatin and adding 5 ml media
Note: If maintaining as stem cells, these should have irradiated MEFs also
Trypsinze with 4 ml per 10 cm plate for 5 minutes at 37ºC
Add 10 ml ES media, transfer to 15 ml conical and spin 5 min 1000 rpm
Remove supernatant and resuspend in 10 ml PBS (no Ca++/Mg++)
Count cells
Spin 5 min 1000 rpm.
Remove supernatant and resuspend at 1e7 in PBS
Aliquot 0.8 ml cell solution in 0.4 mm cuvette (control) (8e6 cells)
Aliquot 0.8 ml cell solution with 20 - 25 µg of linearized DNA at 1 µg/ml in 0.4 mm cuvette
Note: Make sure there are no bubbles in the cuvette
Incubate RT 5 min
Electroporate with the following settings:
250 V
400 µf
Resistance at infinity
Cuvette 4
Note down the time constant (should be 7 to 8)
Incubate RT 5 min
Note: There should be bubbles on top from shock and exploded cells floating on top
Transfer cuvette contents to 50 ml conical containing 20 ml prewarmed media
Aliquot 5 µl to each of the 4 gelatin coated plates already containing 5 ml media
Incubate 24 hours before adding selection agent
Change media every day
Harvest at 48 to 72 hours