CRISPR/Cas9

Overview

This protocol is for designing CRISPR RNA constructs that will target specific loci in the genome. When co-transfected into cells with the Cas9 enzyme, the CRISPR RNA will guide Cas9 to the locus and Cas9 will cut the target site. Non-homologous end joining (NHEJ) repair of this cut will result in small insertions and deletions (indels), so the technique can be used to knockout genes. If short, homologous DNA is also included in the transfection, the technique can also be used to insert this DNA into the cut site. The technique was first described by Mali, et al., in Science, 2013. The technique was further modified by Hwang, et al., Nature Biotechnology, 2013. This protocol is based on modifications developed by Dr. Branden Moriarity.

CRISPR stands for clustered regularly interspaced short palindromic repeats. The image below shows the target sequence, the PAM sequence, and the trace sequence of an example of the CRISPR/Cas9 system. This image is from Hwang, et al., Nature Biotechnology, 2013

Protocol

Plasmids required:

• pU6-gRNA (empty)
• pT3.5 Caggs-FLAG-hCas9
• pcDNA-PB7
• pPBSB-CG-LUC-GFP (Puro)(+CRE) (or any other puro containing transposon)

Step 1: Identify your target sequence

• Open the ZiFit Targeter program created by Keith Joung at Mass General Hospital as part of the Zinc Finger consortium
• Select "CRISPR/Cas" option under Design Genome Editing Nucleases.
• Enter your genomic DNA target sequence in FASTA format. You can play with the size that you want to enter here
• Enter "g" In the 5' NT preference box
• Select "Identify all target sites (U6)"
• Select "Save to CSV"
• The program will download a file called results.xls. Copy this file to your own spreadsheet. This file will contain possible target sites. All target sites will be 20 bp and they will all begin with G. Remember, that the PAM sequence (NGG) is NOT included in this sequence, although it is present in the genomic sequence and it is essential for good activity.This program also gives oligo1 and oligo2 sequences which can be used to create an expression plasmid, but this protocol does not use that method.
  • To choose the best option, blast the target sites and pick the one with the fewest possible off-target hits

Step 2: Order primers to create the pU5-gRNA plasmid containing your target site sequence

• The common reverse primer sequence is: 5' cggtgtttcgtcctttccac 3'. When ordering this primer we recommend using HPLC purification.
• The forward primer should start with the 2nd through 20th bases of the target sequence you identified above. Do NOT include the first G, because it is already present in the pU6-gRNA empty plasmid. The next bases will be: 5' gttttagagctagaaatagc 3'. So the primer should look like this 5' NNNNNNNNNNNNNNNNNNgttttagagctagaaatagc 3'.

Step 3: Perform inverse PCR using your primers and the pU6-gRNA empty plasmid

PCR Cocktail

PCR Program

Step 4: Create pU6-gRNA-targeted plasmid from PCR product

• Run PCR product on 0.8% Agarose gel
• Cut and purify ~3kb band using a gel purification kit
• Phosphorylate and religate using T4 polynucleotide kinase and T4 Ligase

Ligation Reaction

• Liagate-phosphorylate for 5 minutes at 37ºC. (Can go longer).

Step 5: Clone the pU6-gRNA-targeted plasmids

• Heat shock 100 µl of calcium competent E. Coli with 10 µl of ligation reaction. 30 sec 42ºC.
• Plate overnight on Kan plates
• Pick 2 colonies, grow overnight, perform plasmid mini-preps, verify plasmid by sequencing with M13 forward primers.

Step 6: Transfect and select cell of choice

Note:The PB transposon and transposase are included in order to be able to select and enrich for cells that have successfully been modified by CRISPR nucleases. You can omit these plasmids if you want.

• Use your transfection method of choice to transfect cells with four plasmids:
  • pU6-gRNA-targeted (2 µg)
  • pT3.5 Caggs-FLAG-hCas9 (2 µg)
  • pcDNA-PB7 (500 ng)
  • pPBSB-CG-LUC-GFP (Puro)(+CRE) (500 ng)
• After transfection allow cells to recover for 72 hrs.
• Trypsinize and re-plate cells at low density in 96 well plates and place under Puro selection.
  • Note: Low density is cell-line dependent.
    • HCT116 cells require 2,000 to 3,000 cells/well
    • S462TY cells required 100-200 cells/well
• Monitor wells at 4 and 8 days after plating to identify wells with single colonies. Discard wells with multiple colonies or no colonies.
• Expand wells containing single colonies into 24 well plates.
• Harvest a portion of cells for DNA extraction and analysis

Step 7: Asses single cell clones for genome editing

• Generate PCR amplicons using primers that span the CRISPR binding site.
• Sequence the PCR products.