Vibrio Cholerae

Cholera is one of the oldest diseases around. As such, it’s difficult to pinpoint exactly when it was discovered or who discovered it. The case of cholera is interesting since the bowel symptoms it presents are commonly found in other diseases as well. That being said, early Sanskrit literature from 500 BC mentions a condition known as Visuchika, during which cholera like symptoms are seen in a patient. Epidemiologists today believe that this is the first written existence of Cholera. Cholera has presented itself in multiple pandemics, with the current pandemic beginning in the 1960’s. The first known pandemic was discovered in September 1817 by Dr. Tytler, a surgeon in the Indian town of Jessore, who recorded widespread bowel problems and death in 4 to 20 hours. It spread to the entirety of Southeast Asia through Portuguese trade routes, and lasted till 1824.

BSL Classification and Growth

Vibrio cholerae are classified as BSL 2. Different kinds of agar can be used to culture Vibrio cholerae. The ATCC lists #18 Trypticase Soy Agar/Broth (a Soybean-Casein digest medium). However, the DIFCO manual suggests several alternatives, including Heart Infusion Agar, Mueller Hinton Agar, and Thiosulfate Citrate Bile Salts Sucrose (TCBS) Agar. 1. Vibrio cholerae does not require salts to grow and will not survive in test tube form for more than a couple days, even with refrigeration. This stresses the urgency of plating immediately after rehydration.

About the DIsease (Backgrounds/Treatment)

About the Disease Cholera

Vibrio cholerae is indeed a common and fatal pathogen found around the world. As its name implies, it is responsible for causing the disease Cholera. While Cholera is no longer a threat in the United States, the disease is still widespread in parts of Asia and Africa, causing 4 Million causes a year. It has no benefits to the host.

Cholera is found is regions with poor sanitation resulting in contaminated water. It can also live in saltwater, which is why some people getting affected by eating raw shellfish¹. South Asia and Sub Saharan Africa are regions that are most affected right now, however turmoil leading to poverty and poor hygiene in the middle east has led to increases in cases in places like Yemen. Contraction of the disease can be prevented through improved hygiene and handwashing. Cholera spreads through contaminated waters/fecal matter, which is why its generally found in lower developed countries with widespread hygiene problems.

Noteworthy Treatment and Research

Antibiotics play a secondary role in treatment of Cholera. Cholera has to be primarily treated with rehydration therapy, which involves drinking many liters of water with Oral Rehydration Solution, which contains saline, glucose, and lactate4. In very severe cases, some antibiotics are used such as Tetracycline and quinolone antibiotics, but their use must be very limited because of resistance that is emerging in some strains. Most studies of Vibrio cholerae are done with the intend of identifying additional virulence factors. With Cholera being such a major disease around the world, its important to find new ways to eradicate the microbe. However, Vibrio cholerae is also used to study virulence because of its high infectious dose. It’s also an important microbe that is studied for cell signaling pathways.

Visualize Vibrio Cholerae

This image is a gram stain of Vibrio cholerae, which shows the bacteria stained as pink. This means that they are gram-negative, and don’t have cell walls with high peptidoglycan

Scanning Electron Microscope image of Vibrio cholerae sticking to a layer of mucus

Transmission Electron Microscope image that was stained with uranyl acetate

Confocal microscope image of Vibrio cholerae stained using phalloidin dye (red epithelial cells) and GFP (green fluorescent protein) which stains the bacteria green

Differentiate Vibrio Cholerae

In addition, there are many strains and serogroups of Vibrio cholerae, which is why it’s important to be able to differentiate between strains that cause disease and strains that do not. In general, the O1 serogroup is the only one to cause epidemics, and it can be identified using an Agglutination test.

Agglutination, like that in the image on the right, is indicative that a strain belongs to the O1 serotype, meaning that it is more dangerous. However, for the purposes of this assignment, I’ll be focusing on mainly the tests used to differentiate my microbe itself rather than it’s individual subtypes, since that can get slightly complicated.

Blood Agar

Vibrio cholerae does show growth on a blood agar plate and shows alpha hemolysis. This is partial hemolysis, which is when hydrogen peroxide produced by the bacteria react with the hemoglobin. This shows that the bacteria can destroy red blood cells.

MacConkey

Vibrio cholerae does grow on MacConkey agar, which means that it is a gram-negative bacterium. There is also little or no red color, meaning that it is a lactose negative bacterium.

Mannitol

The MSA test would be negative for Vibrio cholerae, which is a sign that the bacteria does not ferment the sugar mannitol. It also means that the bacteria is intolerant to salt conditions.

DNAse

The DNAse test forVibrio cholerae is positive, which means that it polymerizes DNA to form colorless zones around the points of inoculation. Although the image isn’t of my bacteria, it shows the same results

Phenol Red Broth

This shows a test that is positive for glucose fermentation, since the color changed from red to yellow, but negative for gas production, since there is no liquid that leaves from the Durham tube. This isn’t an image of Vibrio cholerae, but the same results. From this, we know that the bacteria can utilize glucose as an energy source.

SIM Medium Deep Agar

Although the image displayed is not from Vibrio cholerae, the results are exactly the same. Based of the first test, the lack of black precipitate implies that the microbe is sulfur negative. Based on the 2^nd test, the change of color to red shows that the test is indole positive. And based on the third test, the change in turbidity implies that the microbe has motility.

Catalase

This image shows a positive Catalase test, although not for Vibrio cholerae. A positive catalase test means that a bacterium contains the enzyme catalase, which takes hydrogen peroxide and breaks it down into water and glucose. This reaffirms that Vibrio cholerae can grow in oxygenated conditions.

Oxidase

This image shows a positive oxidase test for Vibrio cholerae. The positivity is indicated by the change in color to dark purple that occurs within the first 10 seconds of the test.

Molecular Diagnostics

The primers are a 16S rRNA sequence that is found in all Vibrio cholerae species along with other species of the vibrio genus and sometimes even genus’ of other enterobacteria.

Forward: CGGTGAAATGCGTAGAGAT Tm: 48.9 ^oC GC Content: 47%

Reverse: TTACTAGCGATTCCGAGTTC Tm: 49.7^oC GC Content: 45%

Additional Info

Practically, 16S rRNA Primers are difficult to use with and Vibrio species because they aren’t specific enough to a single species. Instead, ompW gene primers are used to amplify a region that codes for an outer membrane protein to add specificity to a pcr test.

Forward: 5′-CACCAAGAAGGTGACTTTATTGTG-3′

Reverse: 5′-GAACTTATAACCACCCGCG-3′

*the long and repetitive FASTA sequence is not included

About the Researcher

My name is Bhargav Kansara and I'm a junior at UF. Like everyone in this website, I'm a microbiology major, and I'm also on the premed track. I love studying microbiology, and doing this project introduced me to a microbe that I don't know a lot about.

A few fun facts about me

I was born in New Jersey, but I moved to Florida when I was 9 years old.
My favorite sports are football, soccer, and cricket
I love watching movies. Some of my favorites are The Dark Knight, Pursuit of Happiness, The Prestige, and the entire MCU besides Iron Man 2
I hope to become a physician one day and go into pathology or diagnostics.

References

Wilson DE, Chosewood LC. Biosafety in Microbiological and Biomedical Laboratories 438.

2009. Difco & BBL Manual: manual of microbiological culture media2. ed. Becton, Dickinson, Sparks, MD.

Barua D. 1992. History of Cholera, p. 1–36. In Barua, D, Greenough, WB (eds.), Cholera. Springer US, Boston, MA.

Macnamara NC. 1876. A History of Asiatic Cholera. Macmillan.

Hays JN. 2005. Epidemics and Pandemics: Their Impacts on Human History. ABC-CLIO.

Figure 2 Gram-negative curved rods (white arrows show comma-shaped... ResearchGate.

Wilson DE, Chosewood LC. Biosafety in Microbiological and Biomedical Laboratories 438.

Yamamoto T, Yokota T. 1988. Electron microscopic study of Vibrio cholerae O1 adherence to the mucus coat and villus surface in the human small intestine. Infect Immun 56:2753–2759.

(PDF) Electron Microscopic Visualization of Capsular Material of Vibrio cholerae O139 Strains with Ruthenium Red Staining. ResearchGate.

Nielsen AT, Dolganov NA, Otto G, Miller MC, Wu CY, Schoolnik GK. 2006. RpoS Controls the Vibrio cholerae Mucosal Escape Response. PLOS Pathogens 2:e109.

Keshav V, Potgieter N, Barnard T. 2009. Detection of Vibrio cholerae O1 in animal stools collected in rural areas of the Limpopo Province. Water SA 36:167–171.

Nandi B, Nandy RK, Mukhopadhyay S, Nair GB, Shimada T, Ghose AC. 2000. Rapid Method for Species-Specific Identification of Vibrio cholerae Using Primers Targeted to the Gene of Outer Membrane Protein OmpW. J Clin Microbiol 38:4145–4151.

2019. Cholera - Vibrio cholerae infection | Cholera | CDC.

Vibrio cholerae on MacConkey agar. Colony appearance: colonies of Vibrio cholerae on MacConkey agar tend to be small to moderately sized and usually appear as lactose-negative.

Team E. 2020. Mannitol Salt Agar - Plate, Test, Composition, Preparation, Uses. LaboratoryInfo.com.

Team E. 2020. Deoxyribonuclease (DNase) Test - Principle, Procedure, Uses, Result Interpretation. LaboratoryInfo.com.

2019. Phenol Red Fermentation Test - Procedure, Uses and Interpretation. Microbiology Info.com.

Aryal S. 2015. Catalase Test- Principle, Uses, Procedure, Result Interpretation with Precautions. Microbiology Info.com.

Vibrio cholerae oxidase test. bacteriainphotos.com.

2018. Sources of Infection & Risk Factors | Cholera | CDC.

Ojeda Rodriguez JA, Kahwaji CI. 2020. Vibrio CholeraeStatPearls. StatPearls Publishing, Treasure Island (FL).

Yoon S hun, Waters CM. 2019. Vibrio cholerae. Trends in Microbiology 27:806–807.

Sharmila T, Thomas TA. 2018. Pathogenesis of Cholera: Recent Prospectives in Rapid Detection and Prevention of Cholera. Bacterial Pathogenesis and Antibacterial Control https://doi.org/10.5772/intechopen.74071.

Google Sites

Report abuse