Introduction

The first documentation of this was by Maxey in Idaho in the 1890s. At that time, they did not know how virulent and pathogenic that microbe was. Howard Ricketts was the first one to identify the disease nature of this microbe, and was later named after him. Rickettsia rickettsii is a BSL 3 microbe. It has also been classified that it could be used in biological warfare against humans. In laboratory settings, the Rickettsia rickettsii cannot be grown in an agar plate or in a broth. It has to be transmitted into a eukaryotic host cell in order to be manipulated and observed properly. They are aerobic organisms. Once it arrives, the procedure for growing it is to follow basic protocols. You obtain the frozen bacterial stock and you thaw them. Next, you have to dilute them with Dulbecco’s modification of Eagle medium (DMEM) and 2mM L-glutamine. Then you transfer the dilution to the Vero cell monolayers. Then you incubate and gently shake it for 4 hours. Remove the media from the Vero cells and dilute it again and incubate it. Every one to two days, check for infection levels and see if that is the level that you would want to work with. Some special instructions include that if the media turns yellow or starts to grow on the sides of the flasks, then this means that you will have to purify it again. Make sure to meet certain temperature and atmosphere requirements in order to maximize results.

Taxonomy

Domain: Bacteria

Kingdom: Proteobacteria

Phylum: Alphaproteobacteria

Class: Rickettsiales

Order: Rickettsiaceae

Genus: Rickettsia

Species: Rickettsia

Visualizing the microbe

They are gram negative bacteria that stain pink. This means that the microbe has a thin peptidoglycan layer and two lipid bilayers surrounding it. The morphology of this microbe is bacilli.

Diagnostic tests

These are the 16s Primers that I will use:

1st: 90 f [AATCTAGAACGAACGCTATCGGTAT] 28-47

2nd: 86 f [AATCTAGATACCAACCCTTGACATG] 939-95

The first primer has a melting temperature of 74 degrees celsius and a 30% GC content.

The second primer has a melting temperature of 79 degrees celsius and a 35% GC content.

>primer1

ACGTACGTACGT

>primer2

TGCATGCATGCA

Disease and treatments

Most Rickettsia diseases are caused by a tick. Ticks are common to see in the mountain regions of West America. There have also been a multitude of cases in South America. Many people living in these areas are not aware of this disease. It is important to increase awareness and prevention methods for everyone living in and traveling to these hot-spot regions.

The fever that is caused by this is called Rocky Mountain Fever. A lot of symptoms are nonspecific and some might be uncommon in many people. Some mainstream symptoms include fever, headache, chills, rash, and a specific tick bite that can be located on the skin. The rash from the tick starts off as small and red. Over time, the rash spreads to other areas of the body and spreads to a bigger region.

In regards to treatments, medications should start as soon as symptoms of this disease are shown. This disease can progress fairly quickly and cause complications in many if treatment is not administered at an early time. Complete blood cell count and content allows the doctor to diagnosis you with this disease and administer medicine that will be receptive to your body. Antibacterial treatment is usually administered.

About the researcher

Name: Anjali Patel

Age: 20

Year: Junior

School: University of Florida

Favorite Color: Blue

Birthplace: Denver, Colorado

Hello everyone! I am a third year microbiology major and have an avid interest in different microbes that roam our world. I love to dance and learn! This activity was very eye opening and allowed me to get an in-depth analysis of a certain microbe.

References

https://jcm.asm.org/content/jcm/32/4/949.full.pdf