About Naegleria fowleri

Introduction:

Naeleria fowleri is the amoeba-like protozoa behind the devastating infection, Primary Amoebic Meningoencephalitis or PAM. The protist is a thermophile and therefore can be found in warm freshwater environments, such as hot springs, rivers, or lakes. The protist is particularly active during the summer months in the southern United States, and usually colonizes the muddy sediment in shallow water. PAM can only occur if water containing N. fowleri enters through the nose, where it can then begin infection in the brain.

Growth Conditions and Instructions:

1. BioSafety Level is #2

2. Agar media is ATCC Medium 1034 or freeze-dried version ATCC Medium 1034: Modified PYNFH Medium (available as ATCC cat. no. 327-X)

Alternate medias are ATCC Medium 710: Nelson's Culture Medium for Naegleria, ATCC Medium 803: M7 Medium and ATCC Medium 902: Schuster's Axenic Naegleria Medium

3. N. fowleri possesses mitochondria and prefers aerobic conditions, but can survive under anaerobic conditions as well. The organism grows best at 35 degrees Celsius in an axenic environment, one devoid of other microbes, but can also thrive in the presence of a bacterial species that can serve as a food source for the predatory protozoa.

4. Frozen cultures must be thawed immediately in a water bath at 35 °C for approximately 23 minutes or stored in a freezer at -70 °C for no more than one week. After thawing, culture must be placed in a tube or flask containing ATTC Medium 1034 or a similar variety. Cultures may then be incubated at 35 °C until later use. Every week, portions of cultures must be aseptically transferred into a new tube of media in order to prevent over-proliferation of cells.

Taxonomy of Naegleria Fowleri

Domain: Eukarya

Kingdom: Protista

-Subkingdom: Protozoa

Phylum: Sarcomastigophora

-Subphylum: Sarcodina

Class: Acarpomyxea

Order: Schizopyrenida

Family: Vahlkampfiidae

Genus: Naegleria

Species: Naegleria fowleri

Visualizing Naegleria Fowleri

Diagnostic Tests for Naegleria Fowleri

PCR Analysis: The sample's DNA can be extracted and amplified with PCR. Afterwards, the amplified DNA can be sequenced and compared with known sequences for N. fowleri. If there is a significant match between sequences, then N. fowleri has been identified

The forward primer Nae3-For (5′-CAAACACCGTTATGACAGGG-3′), with a GC content of 50.0% and a 51.8 degrees C melting temperature, and the reverse primer Nae3-Rev (5′-CTGGTTTCCCTCACCTTACG-3′), with a GC content of 55% and a 53.8 degrees C melting temperature, can be used to identify N. fowleri. This PCR primer pair targets this 183 bp sequence of nucleotide 141 to 323 of the N. fowleri 18S rRNA gene. 18s rRNA was used instead of 16S rRNA since N. folweri is a eukaryote and does not 16 sRNA. Instead, eukaryotes have 18S rRNA, which is homologous to 16S rRNA in prokaryotes.

>AY376150.1 Naegleria fowleri isolate 7852 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

TTGTAGAATGAGGAAGATTTAGGCCATAACAGGTCTGTGATGCTCTTAGATGTCCTGGGCTGCACGCGTA

CTACAATAACGGTACCAGCGAGCGCTATGGTTTTTTAACCCCTTATCCTAATAGGATTGGGTAAACTTTT

CAAACACCGTTATGACAGGGATCGAGGATTGGAACATCCTCGTGAACGAGGAATTCCTAGTAAGCGTGGT

TCATCATACCACATTGATTACGTCCCTGCCTTTTGTACACACCGCCCGTCGCTCCTACCGATGGGACGAA

GAGATGAACCTGGCGGACCAAACCGTAAGGTGAGGGAAACCAGTTAAATCTATTCGTCTGTAGGAAGGAA

AAGTCGTAACAAGGTCTTCGTAGGTGAACCTGCGTAGGGATCATTTATGGTAAAAAAGGTGAAAACCTTT

TTTTATGGTAAAAAAGGTGTATGGTAAAAAAGGTGAAAACCTTTTTTCCATTTACAAAAAATAACTCTGT

GCAATGGAGCACACGGCTCGTGTATCGATGAAGCCCGCGGCAAAAAGCGATATGTAATGAGATTCGTTAG

CCTCGAGATTCATCAAATTGGTGAACACAGTCTGGAC

Disease and treatments for Naegleria Fowleri

Primary Ameobic Meningoencephalitis:

Naegleria fowleri is a pathogen that causes Primary Amebic Meningoencephalitis, or PAM. PAM begins anywhere from 1 to 9 days after infection by N. fowleri, with the median onset time being 5 days after infection. PAM proceeds through two stages. In Stage 1, symptoms include a severe headache, fever nausea and vomiting. Shortly after, the infection proceeds to Stage 2, where individuals experience a stiff neck, seizures, hallucinations, and altered mental status. Some individuals at Stage 2 can even fall into a coma. This disease is extremely fatal, with only 5 known survivors. Death tends to occur 1 to 18 days after symptoms begin, with the median time being 5 days after. For this reason, many PAM diagnoses do not occur until after death as a result of the autopsy.

Avoiding Infection:

Infection is extremely rare, as N. fowleri can only cause damage if inhaled through the nose. Infection can therefore be avoided by keeping hot, dirty freshwater or tap water out of one's nose. Traditionally N. fowleri is found in warm, freshwater environments with lots of mud and sediment, such as lakes or rivers. It can also be found in hot springs and, in rare cases, in poorly cleaned tap water and pool water. Avoiding the shallow areas of these locations, especially during the summer months, significantly lowers chances for infection.

Disease Signifiance:

N. fowleri is a concern to humans due to the disease it causes, which has a 95% fatality rate and tends to kill individuals less than a week after infection. This is due to the organism literally eating through the brain tissue of its host, causing severe headaches, fever, nausea, seizures, coma and even hallucinations. However, since infection is so rare, the threat posed by N. fowleri is no where near as significant as those posed by other microbial pathogens.

Treatments:

The only standardized treatment for PAM is cooling the body (hypothermia) as well as a breast cancer drug called miltefosine. Currently only 5 known people have survived infection by N. fowleri.