L. monocytogenes is a gram-positive, facultative intracellular rod bacteria. In the 1980s, it was revealed to be a foodborne illness linked to many different foods. While not the most common foodborne illness, L. monocytogenes has the highest mortality rate of foodborne illnesses due to the fact that its virulence factors are very unique. These factors include intracellular mobility and the ability to replicate even at refrigerated temperatures. Recent years have seen a decrease in cases of listeriosis due to advancing methods of detection, prevention, and treatment. Every year, about 1600 people in the United States are infected with listeriosis, and one in five of these people ends up dying as a result of the infection.

Domain: Bacteria

Kingdom: Eubacteria

Phylum: Firmicutes

Class: Bacilli

Order: Bacillales

Family: Listeriaceae

Genus: Listeria

Species: Monocytogenes

Pathogenicity and Disease

L. monocytogenes is a species of pathogenic bacteria. When people eat food that is contaminated with this pathogenic species, they develop a disease called listeriosis. There are many ways in which one can reduce their risk of developing listeriosis. Some of these ways are by thoroughly cooking raw foods from animal sources, washing raw vegetables, separating uncooked and cooked foods, avoiding unpasteurized milk, and washing all cooking materials after handling uncooked foods.

L. monocytogenes is traditionally found in soil and water. It can then contaminate vegetables grown in soil or treated with manure fertilizer. Animals can also carry the bacterium and can contaminate foods that come from animal origins such as meat and dairy products.

People with this disease will often experience fever, muscle aches, and gastrointestinal symptoms. Infection can also spread to the nervous system and cause headache, stiff neck, confusion, loss of balance, and convulsions. Infection during pregnancy is especially concerning as it can cause premature delivery, infection of the newborn, or stillbirth.

Treatment

For minor listeriosis infections, medication may not be required. However, more serious cases of listeriosis are commonly treated with antibiotics. Ampicillin can be used alone in together with another antibiotic, most commonly gentamicin. Intravenous antibiotics are given to individuals who develop septicemia or meningitis.

BSL Level: 2

Type of agar required: Brain Heart Infusion (BHI) Agar

Conditions required: Aerobic

Steps for growth:

1. Open vial according to enclosed instructions.

2. Rehydrate pellet with 0.5 mL of #44 broth. Aseptically transfer the contents to a 5-6 mL tube of #44 broth. Additional test tubes can be inoculated by transferring 0.5 mL of the primary broth tube to these secondary tubes.

3. Use several drops of the primary broth tube to inoculate a #44 plate and/or #44 agar slant.

4. Incubate at 37 degrees Celsius for 24-48 hours.

Primers:

LGS2 : 5'-CCGTGCGCCCTTTCTAACTT-3'

Melting temperature: 54 degrees Celsius

GC Content: 55%

LGS4: 5'-TTTGTTCAGTTTTGAGAGGT-3'

Melting temperature: 46 degrees Celsius

GC Content: 35%

FASTA Sequence:

>NC_017728 Listeria monocytogenes 07PF0776 - nucleotides 242825-243055 (231)

ATTTGTTCAGTTTTGAGAGGTTAGTACTTCTCAGTATGTTTGTTCTTTGAAAACTAGATAAGAAAGTTAG

TAAAGTTAGCATAGATAATTTATTATTTATGACACAAGTAACCGAGAATCATCTGAAAGTGAATCTTTCA

TCTGATTGGAAGTATCATCGCTGATACGGAAAATCAGAAAAACAACCTTTACTTCGTAGAAGTAAATTGG

TTAAGTTAGAAAGGGCGCACG

Listeria (listeriosis): Symptoms, causes and treatments. Medical News Today. MediLexicon International.

Preventing Foodborne Illness: Listeriosis. Centers for Disease Control and Prevention. Centers for Disease Control and Prevention.

Center for Food Safety and Applied Nutrition. Listeria (Listeriosis). US Food and Drug Administration. FDA.

O'Connor L, Joy J, Kane M, Smith T, Maher M. 2000. Rapid Polymerase Chain Reaction/DNA Probe Membrane-Based Assay for the Detection of Listeria and Listeria monocytogenes in Food. Journal of Food Protection 63:337–342.

Listeria monocytogenes (Murray et al.) Pirie (ATCC® 19111™). Listeria monocytogenes (Murray et al) Pirie ATCC ® 19111™.

Rogalla D. 2020. Listeria Monocytogenes. StatPearls [Internet]. U.S. National Library of Medicine.