Introduction/ About the Microbe

Microbe Background

The first documentation of the microbe: The microbe Borrelia burgdorferi was found in 1983 by a group of scientists studying Lyme disease. After several studies conducted to patients where they examined blood samples, lesions on the skin, and internal fluids, they found that the dammini spirochete (borrelia burgdorferi) was the agent responsible for Lyme disease. Even though a group of scientists led this investigation, this microbe carries his name after one of them, Willy Burgdorfer, the one who discovered its specific effects on Lyme disease.

Lyme disease is caused by the bacterium Borrelia burgdorferi. It is transmitted to humans through the bite of infected blacklegged ticks.Lyme disease is the most commonly reported tickborne infection in the United States. CDC has a long-standing commitment to preventing Lyme disease and is on the forefront of Lyme disease prevention and control research. CDC scientists (entomologists, ecologists, and epidemiologists) have been working together to understand the complicated interactions between ticks, small mammals, deer, and people to help fight this illness. They have worked to find easy, effective, and affordable means for people to fight this illness. It is important for people to know and learn more about this disease the microbe that causes it.

TAXONOMY

Gram Stain

Borrelia burgdorferi (b. burgdorferi) is believed to be a gram-negative bacterium. It has a cell envelope that consist of two lipid membranes. Between the two membranes, it has a peptidoglycan membrane. Commonly found in gram-negative bacteria are lipopolysaccharide; however, b. burgdorferi lacks lipopolysaccharides. This led to be believed that it was not a gram-negative bacterium still when stained, the bacteria showed a light pink color. It was concluded that b. burgdorferi has immunoreactive glycolipids that act as lipopolysaccharide. The debate still continues about classification of gram-negative or positive for b. burgdorferi. When a bacteria stains pink it means that its peptidoglycan layer does not retain the crystal violet.

Morphology of the cell

It has a spiral shape (spirochete). b. burgdorferi has flagella that are located inside the periplasmic space. These structures are attached at each end and they rotate in opposite directions, increasing and releasing pressure. This movement is what allows the microbe to move in that snake-like way.

How to grow the microbe

BSL Level: 2

Agar needed for growth: Trypticase soy/agar broth with defibrinated sheep blood, and BSK medium.

Aerobic/ Anaerobic conditions: The conditions must be Aerobic.

Procedure for growth:

1. Once it arrives, open the hawed vial according to the instructions provided

2. Transfer all the contents to a 5-6mL tube of the BSK broth needed for incubation. Mix well.

3. Transfer one-tenth of the cell suspension to two additional tubes of fresh BSK broth

4. Use drops of the first broth tube to inoculate a sheep blood plate to rule out contamination. No growth should appear.

5. Incubate at 37 ℃ for 5-6 days.

Additional instructions: The medium will change color from orange to red because of acid formation, but no turbidity should be present. Borrelia burgdorferi is a sensitive organism; therefore, it must be kept in the appropriate medium to grown. Rabbit serum is essential for this organism to grow. Medium must be fresh.

Visualizing the microbe

Diagnostic Tests

Disease and Treatments

The Disease

Is it a pathogen? What disease does it cause? Or does it have any benefits to the host?

Borrelia burgdorferi (b. burgdorferi) is a pathogen that causes the prevalent illness known as Lyme disease. Currently, there is no beneficial relationship of this pathogen with the host, as Lyme disease can be fatal for people who contract it.

How can infection or contraction of the disease be prevented

Since ticks, the animals through which b. burgdorferi transmits the disease, are found in woody and natural areas, the best way to prevent the infection is using insect repellent, wearing covering clothes (avoid skin exposure if is not necessary), and be conscious if you think you might have been exposed to the disease. People can get Lyme disease more than once.

Where is it traditionally found?

Borrelia burgdorferi transmits Lyme disease to hosts through the bite of animals known as ticks. Ticks are usually found in woody and grassy areas, so they are likely to be around national parks, lakes, and other open spaces where there is an abundance of vegetation. Ticks are approximately 1 to 3 centimeters in size, which makes them almost impossible to recognize if exposed to them. These animals bite their hots and transmit the disease to their skin, that later goes into the blood stream. For transmission, ticks need to be attached for 24-48 hours, since they are so small is possible for them to be attached during this period of time unnoticed.

Why do people care about it?

Lyme disease is a widely study illness because, even though if treated people can learn to live with it, more than 13% of the cases can develop serious complication and even lead to death. It has been proven that more than 10% of the people who get diagnose and go under treatment, develop what is called “Post – treatment Lyme disease complication” (Allison DeLong, Mayla Hsu, and Harriet Kotsoris. 2019.). These complications can include severe and prolongated fatigue, long-term pain symptoms, and even cognitive dysfunction. These investigations have encouraged the need for more extensive investigation about the microbe b. burgdorferi and the disease it causes.

Treatment

What Antibiotics work against your bacteria? Are there any other treatments for it?

The way to treat and cure Lyme disease is by the administration of antibiotics. The most effective ones are Doxycycline, Ceftriaxone, Amoxicillin or Cefuroxime. Even though the administration of antibiotic is successful on treating the illness, people might still experience some symptoms even after the treatment.

Primers and FASTA Sequence

PRIMERS

Primer_F

5’-ATGCACACTTGGTGTTAACTA-3’

Melting Temperature: 54°C

GC content: 38%

Primer_R

5’-GACTTATCACCGGCAGTCTTA-3’

Melting Temperature: 58°C

GC content: 48%

FASTA SEQUENCE

>NR_044732.2:816-1166 Borreliella burgdorferi strain ATCC 35210 16S ribosomal RNA, partial sequence

ATGCACACTTGGTGTTAACTAAAAGTTAGTACCGAAGCTAACGTGTTAAGTGTGCAGCCTGGGGAGTATG

CTCGCAAGAGNGAAACTCAAAGGNATTNANNNGNGCCNGCACAAGNNGTGGAGCATGTGGTTTNNNNNNA

NNNTACGCGAGGAACCTTACCAGGGCTTGACATATATAGGATATAGTTAGAGATAATTATTCCCCGTTTG

GGGTCTATATACAGGTGCTGCATGGTTGTCGTCAGCTCGTGCTGTGAGGTGTTGGGTTAAGTCCCGCAAC

GAGCGCAACCCTTGTTATCTGTTACCAGCATGTAATGGTGGGGACTCAGATAAGACTGCCGGTGATAAGT

C

References

• Olga V. Morozova, Andrey K. Dobrotvorsky, Natalya N. Livanova, Sergey E. Tkachev, Valentina N. Bakhvalova,Anatoly B. Beklemishev, and Felipe C. Cabello2. 2002. PCR Detection of Borrelia burgdorferi Sensu Lato, Tick-Borne Encephalitis Virus, and the Human Granulocytic Ehrlichiosis Agent in Ixodes persulcatus Ticks from Western Siberia, Russia. 40(10): 3802–3804. doi: 10.1128/JCM.40.10.3802-3804.2002.

• Faith Kung, Juan Anguita,and Utpal Pal. 2013. Borrelia burgdorferi and tick proteins supporting pathogen persistence in the vector. Future Microbiol. 8: 41–56.

• Allison DeLong, Mayla Hsu, and Harriet Kotsoris. 2019. Estimation of cumulative number of post-treatment Lyme disease cases in the US, 2016 and 2020. BMC Public Health. 19: 352.

• A C Steere, R L Grodzicki, A N Kornblatt, J E Craft, A G Barbour, W Burgdorfer, G P Schmid, E Johnson, S E Malawista.1983. The spirochetal etiology of Lyme disease. N Engl J Med. 308(13):733-40. doi: 10.1056/NEJM198303313081301

• Bryan Troxell , Haijun Xu, X Frank Yang. 2012. Borrelia burgdorferi, a pathogen that lacks iron, encodes manganese-dependent superoxide dismutase essential for resistance to streptonigrin.J BiolChem.287(23):19284-93.doi: 10.1074/jbc.M112.344903

• Wenyuan Shi,Zhaomin Yang, Yongzhi Geng,Lawrence E. Wolinsky, and Michael A. Lovett. 1998. Chemotaxis in Borrelia burgdorferi. 180(2): 231–235. PMID: 9440510

• J. Seshu, Julie A. Boylan, Frank C. Gherardini, and Jonathan T. Skare. 2004. Dissolved Oxygen Levels Alter Gene Expression and Antigen Profiles in Borrelia burgdorferi. Infect Immun. 72(3): 1580–1586. doi:0.1128/IAI.72.3.1580-1586.2004

• Gil Ben-Menachem , Joanna Kubler-Kielb, Bruce Coxon, Alfred Yergey, Rachel Schneerson. 2003. A newly discovered cholesteryl galactoside from Borrelia burgdorferi. Proc Natl Acad Sci U S A. 100(13):7913-8. doi: 10.1073/pnas.1232451100

• Syed Z. Sultan,a Akarsh Manne,a Philip E. Stewart,b Aaron Bestor,b Patricia A. Rosa,b Nyles W. Charon, and M. A. Motaleb. 2013. Motility Is Crucial for the Infectious Life Cycle of Borrelia burgdorferi. Infect Immun. (6): 2012–2021. doi: 10.1128/IAI.01228-12

About the Researcher