Plasmodium Falciparum

BACKGROUND

Plasmodium falciparum is pathogenic.
It is the most severe and deadly form of the parasite.
It causes malaria, which spreads rapidly in the blood and can result in death if not treated immediately.

Epidemiology

Plasmodium falciparum can be found worldwide
It is prevalent in Africa and tropical or subtropical regions.

Pathology

People care about this microbe because it is difficult to fight
The parasite has not been eradicated because it is an ongoing cycle of infection
- - For instance, it is able to quickly change its surface, since it is transmitted through mosquito, so it remains undetectable by humans

Ecological Application

One ecological application on this microbe is that it is typically found in rural areas.

PREVENTION AND TREATMENT

Prevention

Use mosquito repellent to ward off mosquitoes from biting, since it is transmitted through these insects.
Travelers should also wear long sleeve shorts, pants, and socks, especially towards the evening
Also recommended to wear close-toed shoes.

Teatment

Atovaquone-proguanil (Malarone)
Artemether-lumefantrine (Coartem)
Another treatment is chloroquine, but it will only be effective if the parasite is sensitive to the drug.

GROW P. FALCIPARUM

BSL level

The Biosafety Level for this microbe is 2

Agar

RPMI 1640

Anaerobic/Aerobic

This microbe needs to be in aerobic conditions and is unable to thrive in reduced oxygen levels

Procedure

Place frozen vial in water bath so it can thaw
Transfer the contents to a 50ml conical tube
Add .1 ml of 12% NaCl to sample and agitate continuously
Allow mixture to stand for 5 minutes until at room temperature
Slowly add 5 ml 1.8% Sodium Chloride and allow to stand at room temperature for 2 mins.
6. Add 5 ml of 0.9% Sodium Chloride / 0.2% Glucose solution as in step 5. 7.
Centrifuge for 5 min., remove supernatant.
Wash pellet in 20 ml incomplete medium.
Centrifuge for 5 min, remove supernatant.

10. Resuspend pellet in 8ml complete medium culture with gas mixture of 5% CO2, 5% O2 and 90% N2. Tighten cap of the flask and place in 37°C incubator.

11. Follow protocol for maintenance of culture.

Special Instructions

The storage temperature should be frozen at -70 degrees Celsius or even colder for about one week. Any temperature higher than this will result in death of the culture.

Documentation/Discovery

This microbe was first discovered by Alphonse Laveran, a French military physician in 1880
However, Ronald Ross was the first to discover that it was transmitted through mosquitos in 1897
The first documentation on the atcc.org website dates back to 1966
- - This documentation was made by JB Jensen

VISUALIZE P. FALCIPARUM

Stain

This microbe is studied using a Giemsa stain
The stain dyes human cells purple and bacterial/parasitic cells pink
The purpose of this is to detect if the parasite, Plasmodium Falciparum, is in the bloodstream .

Morphology

The cells of this parasite are ring-shaped
A mature one Is around 8 to 12 micrometers long and 3 to 6 micrometers wide.

Microscope

There are many visualizations of Plasmodium falciparum
Typically viewed traditionally using a Transmission Electron Microscope.
The stain used for this microbe is the Giemsa stain.

DIFFERENTIATION

MOLECULAR DIAGNOSTICS

Primer

The primer used for the sequencing of the 16s rRNA gene of Plasmodium Falciparum is F2
The sequence is CAATCTAAAAGTCACCTCGAAAGATG

Melting Temperature

77.6 degrees Celsius

GC content

It has a low GC content of around under 20 percent. It is typically 23.79%.

Fasta Sequence

I was unable to find my microbe in the silico PCR website, so I am not able to attach the FASTA format of the sequence.

References

Jensen JB, Trager W. 1976. Human malaria parasites in continuous culture. Science 193: 673-675. PubMed: 781840

3. 2015. Discovery of the Malaria Parasite. Cdc.gov.

Komaki-Yasuda K, Vincent JP, Nakatsu M, Kato Y, Ohmagari N, et al. (2018) A novel PCR- based system for the detection of four species of human malaria parasites and Plasmodium knowlesi. PLOS ONE 13(1): e0191886. https://doi.org/10.1371/journal.pone.0191886

Sachanonta N, Chotivanich K, Chaisri U, Turner G, Ferguson D, Day N, Pongponratn E. 2011. Ultrastructural and Real-time Microscopic Changes in P. falciparum-infected Red Blood Cells Following Treatment with Antimalarial Drugs. Ncbi.nlm.nih.gov.

2018. CDC - Malaria - Diagnosis & Treatment (United States) - Diagnosis (U.S.). Centers for Disease Control and Prevention. Centers for Disease Control and Prevention.

2018. Malaria. Mayo Clinic. Mayo Foundation for Medical Education and Research.

2020. CDC - Malaria - About Malaria - FAQs. Centers for Disease Control and Prevention. Centers for Disease Control and Prevention.

Google Sites

Report abuse