Corynebacteria glutamicum

Growth and safety information

1. Corynebacteria glutamicum is at a biosafety level of 1

2. Corynebacteria glutamicum grows in medium 3: nutrient agar or nutrient broth

3. Corynebacteria glutamicum is an anarobic organism that’s should be grown in anaerobic conditions

4. Once Corynebacteria glutamicum arrives, check containers for leakage/breakage and place cells in a temperature bellow -130 degrees C

5. Corynebacteria glutamicum requires hypoxanthine and biotin

Visual information

1. Is it a gram stain?

Figures 2 and 3 are a gram stain in the same genus as Corynebacterium glutamicum. Figure 2 depicts Corynebacterium pseudotuberculosis and figure 2 depicts Corynebacterium diphtheriae

• What does the color tell us about the bacteria?

The color of the bacteria in the gram stain is purple. This means that the bacteria is gram positive due to the thick layer of peptidoglycan that is able to hold the crystal violet dye used in the gram staining process.

2. What is the morphology of the cells?

• Coccus/Bacillus/etc

Corynebacterium diphtheriae is a club shaped bacillus. This means that the shape of the bacteria is rod like and curved and is seen well in Figure 1.

3. Are there any other visualizations of it?

1. SEM - Scanning Electron Microscope

2. TEM - Transmission electron microscope

3. Confocal

Figure 1 is a computer-generated image that was created using scanning electron microscope (SEM) imaging. SEM imaging uses a beam of electrons to penetrate the surface of microscopic objects to create a scan of the objects surface and composition.

Figures 4 and 5 depict Corynebacterium diphtheriae surface layers under an atomic force microscope (AFM.) AFM uses a sharp cantilever to scan over the surface of microscopic organisms. This type of imaging allows for the detection of ridges and is able to generate an image based on attractive forces between the cantilever and the surface of the object. AFM provides detailed imaging of the surface of objects that are too small to see with powerful microscopes.

The difference between AFM and SEM is in the dimensions of the images produced. AFM renders a three-dimensional image while SEM is in two dimensions.

Figure 2 was taken with a 1150X microscope and Figure 3 was taken with a 800X microscope and both figures are gram stained.

No growth on MaConkey agar- Gram positive

MaConkey agar plate-

The MaConkey agar test is selective and differential. It uses bile salts to inhibit the growth of gram-positive bacteria and differentiates gram-negative bacteria based on its ability to ferment lactose.

Corynebacteria glutamicum does not grow on MaConkey agar which means that it is a gram-positive bacteria.

Bacillus or coccus-

By visualizing a microbe, you can differentiate different bacteria based on the morphologies and structures

Corynebacteria glutamicum is a bacillus which means that it has a rod like shape. This differentiates Corynebacteria glutamicum from other microbes that have different morphologies such as a circular coccus shape.

Phenol red fermentation test-

Phenol red fermentation test differentiates microbes based on their ability to ferment glucose. If the microbe is able to ferment, then the broth will change from a red color to a yellow color. The test also determines if gas is produced during the fermentation process.

Corynebacteria glutamicum is a glucose fermenter. This means that its able to draw energy from glucose. No gas is produced during this reaction.

Corynebacteria glutamicum can be easily confused with Bacillus megaterium which has the same test results discussed throughout this assignment. Bacillus megaterium has the catalase enzyme, it ferments glucose, has a bacillus morphology and is gram positive.

Molecular Diagnostics

C240F GGAAGGAYGCATCTTGGCAGTCT

1. Melting point: 68 degrees C

2. G-C content: 52.17%

C150F GGYACGCCYGAGTGGC

1. Melting point: 56 degrees C

2. G-C content: 68.75%

   • Amplify 16s sequence in the program and include the specific 16s sequence (in FASTA format) in your submission.

3. >NC_006958, from 1343778 to 1344037 (260 bp); Corynebacterium glutamicum ATCC 13032 Bielefeld CGCCGGAGAGGCGGGCGGGGCGCCGTTCGGCGGCGTCGGTGAGGCCTACTTGTTCGAGGTGGGTGCGGGTGATGTCGGCGCGTTCGGTTTTGCTCAAGGAGGGGCGCGCGGAGCGGAGGCCGAAGTCGATGTTGCCGCGTGCGGTCAATCAGGGCAGGAGGGCGTGGTCTTGGAAAACCATGCCTCGGTCAGGTCCTGGTCCTTTAATTTCTTCGTTGCCTGCGCTGACTGTGCCGGTGGATGGGGAGGCCAGTCCGGCG

4. >NC_006958, from 2254625 to 2256644 (2020 bp); Corynebacterium glutamicum ATCC 13032 Bielefeld

CGCCGGAGCGGCACACGATAAGATCAGCAACGGTGTAGGCAGCCTGCATATCGTCGATAAACGGAACGGGATGGTAGCCGGGTTTCGCTGCAGGCAACTCGTTTTTCTTACCCACGGCGTGGAGCACCTGGAAACCTGCCTCCACCAGCTGATCTACAGCTTGCTCGACGGCCTTGTTGATACTCACAGAGCCCTGCGAACCACCGGTGACAAAAATGGTTTGGCGGTCCTTGTCCAAACCCCAAGTGTCCCTGGCTCGGTCAGCTGCGGACTCATCCCGCGCGCCACTTAAAACAGCACGAATCGGAATGCCCACCACGTCGCCGTCCATGCCGGAACCAGCAACAGCATTAAGGCCAACGCCACCGAGCTTGACGCCCAATTTGTTGGCCATGCCTGCACGGGCGTTGGCTTCGTGGACAAAAAATGGCAAGCCCAAAGACTTCGCCGCCATATAAGCCGGAGCAGATACATAACCGCCAAAGCCGATGACCGCTTGAGCGTCTGTGTCCTTCAGTGCCTTGCGTGCTTGGCCTAATGCCTTAGCTACCCGGAATGGGAGCTTCAACAAATCCATATTGGGCTTGCGTGGGACTGGAACCGGCTCGATGAGATGAAGCTCAAACCCACGATCAGGCACCAGGGTTGTTTCCAAACCACGAGCAGTACCTAAAGCCGAAACTGTTGCACCGTGCTTATCGCGCAGCGCTTCAGCCACTGCCAACGCAGGCTCAATATGTCCTGCGGTACCGCCACCAGCAACGACAACCCGCATGGGTTTTGGGGAGTTAGCCATCTTTATTCGTAGTTCTCCTGATTTCACATTTATCTGCGGTTGCGGTTGTCACGCCAATCATCGCGCGACTCGGAACGGCGCTCGGTAGGCCTGCTTTGACGACTTCGATCAACGCTGCGATCGGCTGCGCGCCCACCAGTAGTTGATTGGCTACGCGCCGTACCTTCGTTGCTTCGACCGTTGTCCTGACCACTGCTTCGACCTTTGACGCTACCAGTCGAGCGTCGCGGAGCTTCCGATTGTACTCCAGCTCGCCCACTTCGTGGCGCCTGCGCTCGGCGTGCGGTCACAGGCTCGCCGAAGCGGTCCCGAGACTCTTTCTGAGGACTCGGCTTTTGTTTAGCGGCCTTGGTTTTGTTGGAACGCAAGGATGCATTACTGGTGGTCAAAGTACTTGAAGGCTCACGCAATCCCAGAAGTCGATCGATTGCGGGGCGTCCATAGGAAGCCATCGCAGAAACTGTCTCTGGTTCGTGGCGTGCACAGCTAATGAGCAAGCCCATGGAAGCCAAGGTAATGATCGCGGAGGTACCACCGGCGGAAATCATGGGCAGCTGAATACCGGTAACTGGCAGCAGACCAACCACGTAGCCAATGTTGATGAACGCCTGCGACACCACGGATGCCGTCAAGGTTGCAGCCATCAAGCCCAAGAATGGATCGTGGCTCTTCTTGGCTGTGCGCAGACCGAAGTACAGCAGCCCCGCGAAAAGTGCGATGACCAGAGCGCCACCCCACAGCCCCAGCTCCTCACCAATGATGGCAAAGATGAAGTCATTTTTAGCTTCGGGCAGGTAGAACCACTTCGCCCTTGATTGGCCCAAACCAACTCCCAAGCCGGAACCATCTGCAAGAGAGAGGAAGCCCTGATAGGACTGGAAGGCAATGCCTCGCACATCGTGGAAATTGCCAAACAGCGCATCGAAATACACCTCGAATCGGCTTGAACGGAAGCCTCCGCCCAATGCCAGGACTGCGAGGGCTGCGATAATCAGTACGCCGGCAATCGCGATCCAACCCATGGCGATGCCCGCAAAAAACAGCATGAACAATACAACCAGCACGAAAGACATCGCCATGCCGGCGTCGCCTTCCATGAAGATCAAAAACGCCATGAATGCACCGACGCCACCAAAACGCATCAAGTGATTATTGAACCAGTGCTGCACAGGGCCCTTGCCTGCGAGGTAGTGCGCTCCCCACACGGCAATGGCCACTTTGGCG

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC516356/