Embedded Files
Análisis de METAGENOMA
Pasos importantes
1. Los archivos de secuenciación se entregan con primer forward y reverse (2 archivos)
2.
BOLD
Blast Ribosomal
https://img.jgi.doe.gov/cgi-bin/m/main.cgi?section=WorkspaceBlast&page=16form
Lista de Primers de BOLD
http://www.boldsystems.org/index.php/Public_Primer_PrimerSearch
Búsquedas de especies en Bold
http://www.boldsystems.org/index.php/Public_BINSearch?searchtype=records
Búsqueda basado en secuencia COI, ITC, rbcl y matK
http://www.boldsystems.org/index.php/IDS_OpenIdEngine
Ratnasingham, S. & Hebert, P. D. N. (2007). BOLD: The Barcode of Life Data System (www.barcodinglife.org). Molecular Ecology Notes 7, 355-364. DOI: 10.1111/j.1471-8286.2006.01678.x
Ratnasingham S, Hebert PDN (2013) A DNA-Based Registry for All Animal Species: The Barcode Index Number (BIN) System. PLoS ONE 8(8): e66213. DOI:10.1371/journal.pone.0066213
COLD SPRING HARBOR
http://www.dnabarcoding101.org/bioinformatics.html
USE BLAST TO FIND DNA SEQUENCES IN DATABASES (ELECTRONIC PCR)
Perform a BLAST search as follows:
Do an Internet search for "ncbi blast."
Click the link for the result BLAST: Basic Local Alignment Search Tool. This will take you to the Internet site of the National Center for Biotechnology Information (NCBI).
Under the heading "Basic BLAST," click "nucleotide blast."
Enter the primer set you used into the search window. These are the query sequences.
The following primers were used in this experiment:
Plant rbcL gene
rbcLa f 5’- ATGTCACCACAAACAGAGACTAAAGC-3’ (forward primer)
Levin et al, 2003
rbcLa rev 5’- GTAAAATCAAGTCCACCRCG-3’ (reverse primer)
Kress & Erickson, 2009
References
Kress WJ, Erickson DL, Jones FA, Swenson NG, Perez R, et al. (2009) Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings of the National Academy of Sciences 106: 18621–18626.
Levin RA, Wagner WL, Hoch PC, et al. (2003) Family-Level Relationships of Onagraceae Based on Chloroplast rbcL and ndhF Data. American Journal of Botany, vol 90:107-115 (modified from Soltis P et al. (1992) Proceedings of National Academy of Sciences USA, 89: 449-451.
Place into the thermocycler and amplify using: 95 °C for 2 min, then 45 cycles of 95 °C for 30 s, 50 °C for 1 min 30 s, and then 72 °C for 40 s. Finish with 72 °C for 5 min and then 30 °C for 10 s
Plant MatK
Forward: matK-xf TAATTTACGATCAATTCATTC Ford et al. 2009
Reverse: matK-MALP ACAAGAAAGTCGAAGTAT Dunning & Savolainen, 2010
MatK-1RKIM-f ACCCAGTCCATCTGGAAATCTTGGTTC Ki-Joong Kim
MatK-3FKIM-r CGTACAGTACTTTTGTGTTTACGAG Ki-Joong Kim,
98°C for 45 seconds;
35 cycles of 98°C for 10 seconds, 54°C for 30 seconds, 72°C for 40 seconds; final extension 72°C for 10 minutes.
Dunning LT, Savolainen V (2010) Broad-scale amplification of matK for DNA barcoding plants, a technical note. Botanical Journal of the Linnean Society 164: 1–9.
Ford CS, Ayres KL, Haider N, Toomey N, van-Alpen-Stohl J, et al. (2009) Selection of candidate DNA barcoding regions for use on land plants. Botanical Journal of the Linnean Society 159: 1–11.
PSA-TrnH
psbA3_f GTTATGCATGAACGTAATGCTC Sang et al. 1997
trnHf_05 CGCGCATGGTGGATTCACAATCC Tate & Simpson, 2003
98°C for 45 seconds;
35 cycles of 98
35 cycles of 98°C for 10 seconds, 64°C for 30 seconds, 72°C for 40 seconds; final extension 72°C for 10 minutes.
Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120–1136.
Tate JA, Simpson BB (2003) Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany 28: 723–737.
http://www.pnas.org/content/106/31/12794.full#F1
In summary, rbcL offers high universality and good, but not outstanding discriminating power, whereas matKand trnH–psbA offer higher resolution, but each requires further development work. Primer universality needs improvement for matK in some clades, and trnH–psbA does not consistently provide bidirectional unambiguous sequences, often requiring manual editing of sequence traces. Thus, no single locus meets CBOL's data standards and guidelines for locus selection, and as a result a synergistic combination of loci is required.
One option preferred by some researchers in the CBOL Plant Working Group was a 3-locus barcode of matK+rbcL+trnH-psbA, to allow further testing of these loci. Based on the relative performance of the 3 loci, the best 2-locus barcode could be selected at a later date. The majority preference, however, was to select a 2-locus barcode to (a) avoid the increased costs of sequencing 3 loci rather than 2 in very large sample sets, and (b) prevent further delays in implementing a standard barcode for land plants. In the datasets examined here, sequencing 3 loci did not improve discrimination beyond the best performing 2-locus barcodes.
Among the 2-locus barcode combinations, rbcL+matK was the majority choice for several reasons. High-quality sequences of rbcL are easily retrievable across phylogenetically divergent lineages, and it performs well in discrimination tests in combination with other loci. Developing amplification strategies for matK was considered an investment with better prospects for return than solving the problem of sequence quality in trnH–psbA caused by mononucleotide repeats (13). Recent primer development for matK has improved its recovery from angiosperms, and so prospects for further improvement in angiosperms and other land plant groups seem reasonable, analogous to the extensive improvements made to primer sets for CO1 for animal DNA barcoding (14).
We therefore propose rbcL+matK as the standard barcode for land plants. This combination represents a pragmatic solution to a complex trade-off between universality, sequence quality, discrimination, and cost. Using rbcL+matK in the sample set examined here, species discrimination was successful in 72% of cases, with the remaining species being matched to groups of congeneric species with 100% success. Given the logistical difficulties of undertaking identifications with some ≈400,000 species of land plant, this 2-locus barcode offers the opportunity to harness high-throughput automated sequencing technologies to establish a powerful universal framework for DNA-based identification of plants.
Vertebrate (non-fish) COI gene
VF1_t1 5'-TCTCAACCAACCACAAAGACATTGG-3' (forward primer)
VR1d_t1 5'-TAGACTTCTGGGTGGCCRAARAAYCA-3' (reverse primer)
Fish COI gene
VF2_t1 5'-CAACCAACCACAAAGACATTGGCAC-3' (forward primer)
FishR2_t15'-ACTTCAGGGTGACCGAAGAATCAGAA-3' (reverse primer )
Fungi ITS
ITS1 F 5’-TCCGTAGGTGAACCTGCGG-3’ (forward primer)
ITS4 R 5’-TCCTCCGCTTATTGATATGC-3’ (reverse primer)
Invertebrate COI gene
LCO1490_F 5’-GGTCAACAAATCATAAAGATATTGG-3’ (forward primer)
HC02198_R 5’-TAAACTTCAGGGTGACCAAAAAATCA-3’ (reverse primer)
Omit any non-nucleotide characters from the window because they will not be recognized by the BLAST algorithm.
Under "Choose Search Set," select "NCBI Genomes (chromosome)" from the pull-down menu.
Under "Program Selection," optimize for "Somewhat similar sequences (blastn)."
Click "BLAST". This sends your query sequences to a server at the National Center for Biotechnology Information in Bethesda, Maryland. There, the BLAST algorithm will attempt to match the primer sequences to the DNA sequences stored in its database. A temporary page showing the status of your search will be displayed until your results are available. This may take only a few seconds or more than a minute if many other searches are queued at the server.
Plant Genotyping. Volume 1245 of the series Methods in Molecular Biology pp 101-118. DNA Barcoding for Plants
Natasha de Vere , Tim C. G. Rich, Sarah A. Trinder, Charlotte Long
The method described here is for the amplification of the DNA barcode markers rbcL and matK. It is optimized for use with herbarium material but also works for freshly collected material that has been stored in silica gel prior to extraction. Table 1 shows primers commonly used for rbcL and matK. rbcL primers are gener- ally universal, working well across a broad taxonomic range; we use rbcLaF and rbcLr590 for the first PCR. If this fails we then use a different reverse primer. matK is more problematic and often requires more primer combinations, especially when using herbarium material. For herbarium material we often use primers specific to the order of flowering plants to which the sample belongs [4]. matK amplification can also sometimes be problematic for nonseed plants and further primer development is required for these [21].
Table 1
rbcL and matK primers commonly used to amplify plant species
Additional primers, including those for particular orders of flowering plants, are also available [4, 21, 31]
Fungal Mitochondrial Small Subunit:
Lohtander, K., I. Oksanen & J. Rikkinen. 2002. A phylogenetic study of Nephroma (lichen-forming Ascomycota). Mycological Research 106: 777-787.
Nelsen, M.P., Lücking, R., Mbatchou, J.S., Andrew, C.J., Spielmann, A.A. & H.T. Lumbsch. 2011. New insights into relationships of lichen-forming Dothideomycetes. Fungal Diversity 51: 155-162.
White, T.J., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 in PCR Protocols: A Guide to Methods and Applications (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.
Zhou, S. & G.R. Stanosz. 2001. Primers for amplification of mt SSU rDNA, and a phylogenetic study of Botryosphaeria and associated anamorphic fungi. Mycological Research 105: 1033-1044.
Zoller, S., C. Scheidegger & C. Sperisen. 1999. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. Lichenologist 31: 511-516.
Fungal Internal Transcribed Spacer (ITS):
*Primer preferentially amplifies fungi.
Many of these primers have been used in combination with each other to amplify the fungal ITS directly from lichen thalli.
SSU positions relative to Saccharomyces cerevisiae J01353
5.8S positions relative to Saccharomyces cerevisiae D89886
LSU positions relative to Saccharomyces cerevisiae J01355
Döring, H., P. Clerc, M. Grube & M. Wedin. 2000. Mycobiont-specific PCR primers for the amplification of nuclear ITS and LSU rDNA from lichenized ascomycetes. Lichenologist 32: 200-204.
Gardes, M. & T.D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
Kroken, S. & J.W. Taylor. 2001. A gene genealogical approach to recognize phylogenetic species boundaries in the lichenized fungus Letharia. Mycologia 93: 38-53.
Larena, I., O. Salazar, V. González, M.C. Julián & V. Rubio. 1999. Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology 75: 187-194.
Lohtander, K., L. Myllys, R. Sundin, M. Källersjö & A. Tehler. 1998. The species pair concept in the lichen Dendrographa leucophaea (Arthoniales): analyses based on ITS sequences. Bryologist 101: 404-411.
Vilgalys, R. & M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
White, T.J., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 in PCR Protocols: A Guide to Methods and Applications (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.
Fungal Nuclear Large Subunit:
Cubeta, M.A., E. Echandi, T. Abernethy & R. Vilgalys. 1991. Characterization of anastomosis groups of binucleate Rhizoctonia species using restriction analysis of an amplified ribosomal RNA gene. Phytopathology 81: 1395-400.
Döring, H., P. Clerc, M. Grube & M. Wedin. 2000. Mycobiont-specific PCR primers for the amplification of nuclear ITS and LSU rDNA from lichenized ascomycetes. Lichenologist 32: 200-204.
Kroken, S. & J.W. Taylor. 2001. A gene genealogical approach to recognize phylogenetic species boundaries in the lichenized fungus Letharia. Mycologia 93: 38-53.
Mangold, A., M.P. Martín, R. Lücking & H.T. Lumbsch. 2008. Molecular phylogeny suggests synonymy of Thelotremataceae within Graphidaceae (Ascomycota: Ostropales). Taxon 57: 476-486.
Nelsen, M.P., Lücking, R., Mbatchou, J.S., Andrew, C.J., Spielmann, A.A. & H.T. Lumbsch. 2011. New insights into relationships of lichen-forming Dothideomycetes. Fungal Diversity 51: 155-162.
Rehner, S.A. & G.J. Samuels. 1994. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625-634.
Vilgalys, R. & M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
Vilgalys Website: http://sites.biology.duke.edu/fungi/mycolab/primers.htm
Algal Ribulose 1,5-Bisphosphate Carboxylase Large Subunit (rbcL):
Manhart, J.R. 1994. Phylogenetic analysis of green plant rbcL sequences. Molecular Phylogenetics and Evolution 3: 114-127.
Nelsen, M.P., E. Rivas Plata, C.J. Andrew, R. Lücking & H.T. Lumbsch. 2011. Phylogenetic diversity of trentepohlialean algae associated with lichen-forming fungi. Journal of Phycology 47: 282-290.
Nozaki, H., M. Ito, R. Sano, H. Uchida, M.M. Watanabe, H. Takahashi & T. Kuroiwa. 1995. Phylogenetic relationships within the colonial Volvocales (Chlorophyta) inferred from rbcL gene sequence data. Journal of Phycology 31: 970-979.
Rindi, F., M.D. Guiry & J.M. López-Bautista. 2008. Distribution, morphology and phylogeny of Klebsormidium (Klebsormidiales, Charophyceae) in urban environments in Europe. Journal of Phycology 44: 1529-1540.
Rindi, F., D.W. Lam & J.M. López-Bautista. 2009. Phylogenetic relationships and species circumscription in Trentepohlia and Printzina (Trentepohliales, Chlorophyta). Molecular Phylogenetics and Evolution 52: 329-339.
Verbruggen, H., M. Ashworth, S.T. LoDuca, C. Vlaeminck, E. Cocquyt, T. Sauvage, F.W. Zechman, D.S. Littler, M.M. Littler, F. Leliaert & O. DeClecrk. 2009. A multi-locus time-calibrated phylogeny of the siphonous green algae. Molecular Phylogenetics and Evolution 50: 642-653.
Zechman, F.W. 2003. Phylogeny of the Dasycladales (Chlorophyta, Ulvophyceae) based on analyses of rubisco large subunit (rbcL) gene sequences. Journal of Phycology 39: 819-827.
Algal Internal Transcribed Spacer (ITS):
*Primer preferentially amplifies algae.
Many of these primers have been used in combination with each other to amplify the algal ITS directly from lichen thalli.
SSU positions relative to Chlamydomonas reinhardtii M32703
5.8S positions relative to Chlamydomonas reinhardtii U66954
LSU positions relative to Pseudochlorella pringhsheimii D17810
Dahlkild, Å, M. Källersjö, K. Lohtander & A. Tehler. 2001. Photobiont diversity in the Physciaceae (Lecanorales). Bryologist 104: 527-536.
Helms, G., T. Friedl, G. Rambold & H. Mayrhofer. 2001. Identification of photobionts from the lichen family Physciaceae using algal-specific ITS rDNA sequences. Lichenologist 33: 73-86.
Hoshina, R., Y, Kamako & N. Imamura. 2005. Genetic evidence of “American” and “European” type symbiotic algae of Paramecium bursaria Ehrenberg. Plant Biology 7: 525-532.
Kroken, S. & J.W. Taylor. 2000. Phylogenetic species, reproductive mode, and specificity of the green alga Trebouxia forming lichens with the fungal genus Letharia. Bryologist 103: 645-660.
Lohtander, K., I. Oksanen & J. Rikkinen. 2003. Genetic diversity of green algal and cyanobacterial photobionts in Nephroma(Peltigerales). Lichenologist 35: 325-339.
Nelsen, M.P. & A. Gargas. 2006. Actin type I introns offer potential for increasing phylogenetic resolution in Asterochloris(Chlorophyta: Trebouxiophyceae). Lichenologist 38: 435-440.
Piercey-Normore, M.D. & P.T. DePriest. 2001. Algal switching among lichen symbioses. American Journal of Botany 88: 1490-1498.
Vilgalys, R. & M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
White, T.J., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 in PCR Protocols: A Guide to Methods and Applications (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.
UPGMA
Page updated
Google Sites
Report abuse