Exercise 3

Given the following pre-miRNA sequence see if you can answer the following questions using your favourite miRNA resources. Good starting points are miRBase, miR2Disease and miRNAmap.

• What is this miRNA? What species could it come from?
• What human diseases, if any, is it involved in?
• In what tissues is this miRNA expressed?

>mir-Q

UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAA