5. Strategies for Expanding Alignments

We will start using the CM hit from our previous example.

>ENA|FN667742|FN667742.1/1133199-1133128 Xenorhabdus nematophila ATCC 19061 chromosome, complete genome

TGAAGATGCGCAAAATTGTTATTATCCCTATTCTCTAAGATACTTTATTCGGCCACCTCC

GGTGGCCATTTT

Option 1: Repeat the Process

My preferred option for expanding alignments is to start the process again from "Finding Putative Homologs" using the new hit as the seed sequence. This way, you'll only ever be automatically aligning sequences outside the "twilight zone," and can manually reconcile these sets of close homologs. In the case of this Xenorhabdus sequence, this will result in something like the attached "xeno_edited.sto" file. Can you reconcile this with our previous MicA alignment?

Option 2: Merge Alignments using Infernal

A second option is to realign all your sequences with Infernal, then use its "merge" functionality to automatically align the new sequence. To do this, run:

cmalign -o xeno_align.sto edited.cm xeno_hit.fa

cmalign -o BLAST.sto edited.cm BLAST.fasta

cmalign -o merged.sto --merge edited.cm BLAST.sto xeno_align.sto

You can then build a new CM from this merged alignment. This has the advantage that it is fast and easy and can be done with a single sequence. However, Infernal is not aware of phylogeny, and hence has occasional problems with subtle indels (see the book chapter for a more detailed discussion of this.) This can lead to it compressing sequence motifs that are more clear in a hand-edited alignment. See the attached merge.sto for an example - can you improve this alignment?

Option 3: When all else fails!

If you are working with either very long, or very divergent sequences, these techniques may fail. See the book chapter for a brief discussion of other options.

Now that we've been through this tutorial, you should be able to start building your own CMs. Try expanding this CM with the Xenorhabdus sequence, or try starting from one of the other sequences linked to in Section 2. Good luck!