How to order Primers
Preferred vendor: IDT
To order from IDT, create a new account on the UMMS IDT portal (www.idtdna.com/umass). Create your order (usually will be ordering Custom DNA Oligos) and check out using the speedtype. If the oligo is ordered by 10pm, delivery will be by 3pm the day after next (ie. if ordered before 10pm on the 1st, delivery will be on the 3rd).
Speed vendor: Eton Biosciences
Have Ann create a purchase order for the lab every few months for a set amount ($200?) that can be used for Eton. Similarly, create an account on the Eton website and check out using the purchase order. If the oligo is ordered by 6pm, delivery will be by 3pm the next day (ie. if ordered before 6pm on the 1st, delivery will be on the 2nd).
How to Resuspend Primers
When we receive primers from IDT, they are in a dry, lyophilized oligo form that needs to be resuspended. IDT has a helpful resuspension calculator which you can access here:
Enter the quantity in nmol, which is usually given on the primer label. Enter the final concentration to be 100 uM (primers are usually stocked at this concentration and then diluted according to individual needs).
The calculator will then indicate how much water/buffer should be added to resuspend the primers in. Make sure to always vortex and centrifuge primer suspensions thoroughly after adding the water.
How to determine size of amplicon from primer
Go to the UCSC Genome Browser
Select In-Silico PCR from the homepage tools options.
Select your genome, assembly from the drop down options. For target, DNA corresponds to genome assembly and RNA corresponds to UCSC genes. Select which one, depending on whether your sample is DNA or RNA.
Copy/paste your Forward and Reverse primer sequences exactly into the appropriate fields and hit submit. If you receive more than one number in the results, make sure the majority of the numbers are the same. The resulting number(s) are the size of your primers and where you should expect to see a band in the gel.
How to make primer diagrams
Go to the UCSC Genome Browser
Select BLAT from the homepage tools options.
Select your genome, assembly and query type. In the text box, enter your primer name and sequence. Preceding the primer name, enter a carrot (>) followed by the primer name. Then hit enter and paste the exact primer sequence. Do this for all the primer sets in your gene. Make sure to follow this format in order to ensure accurate results.
Here is an example on how to enter the primer name and sequence in proper format:
>ACTB_EXON2_F
AGGATTCCTATGTGGGCGACG
>ACTB_EXON2_R
GCCAGATTTTCTCCATGTCGTCC
>ACTB_JCT3_EXON_F
GCCAACCGCGAGAAGATGACC
>ACTB_JCT3_INTRON_R
ggaaaacggcagaagagagaaccag
>ACTB_JCT3_EXON_R
CCATCACGATGCCAGTGGTACG
>ACTB_JCT4_EXON_F
CTGCCCTGAGGCACTCTTCC
>ACTB_JCT4_INTRON_R
gcaggacttagcttccacagcac
>ACTB_JCT4_EXON_R
GTGTTGGCGTACAGGTCTTTGC
Click Submit. Of the results, pick one with 100% identity and click on the browser hyperlink. This will take you to a gene diagram with all your primers placed appropriately on the gene. The diagram will also contain multiple series of information called "tracks". You can right click and "hide" a track in order to just focus on your primers. Primers will show up under a track named "your sequence from BLAT search". You can also right click and select "view image" and your diagram will open separately in a new window, which makes it easy to save a copy of it.