ELABELA (abbreviated ELA) is a secreted peptide acting during embryogenesis
and a hormone circulating in adult plasma.
ELABELA (abbreviated ELA) is a secreted peptide acting during embryogenesis
and a hormone circulating in adult plasma.
Genomic
Genomic
The ELABELA gene is located on chromosome 4q32.3 in humans. It consists of 3 exons with the following genomic coordinates (hg19): chr4:165,798,156-165,818,675 . Exon 1 codes for all the 5’ UTR, the entire signal peptide and 3 residues of the mature peptide. Exon 2 encodes the mature ELA peptide and its Stop codon. Exon 3, which is the largest of all, is entirely consisting of 3’ UTR. In primates but not in rodents, the exon 3 is larger and bears 2 Alu repeats of 300 bp each. The open reading frame (ORF) encoded by the human ELA cDNA is 165 bp in length:
The ELABELA gene is located on chromosome 4q32.3 in humans. It consists of 3 exons with the following genomic coordinates (hg19): chr4:165,798,156-165,818,675 . Exon 1 codes for all the 5’ UTR, the entire signal peptide and 3 residues of the mature peptide. Exon 2 encodes the mature ELA peptide and its Stop codon. Exon 3, which is the largest of all, is entirely consisting of 3’ UTR. In primates but not in rodents, the exon 3 is larger and bears 2 Alu repeats of 300 bp each. The open reading frame (ORF) encoded by the human ELA cDNA is 165 bp in length:
>human ELABELA ORF:
ATGAGATTTCAGCAATTCCTTTTTGCATTTTTTATTTTTATTATGAGTCTTCTCCTTATCAGCGGACAGAGACCAGTTAATTTGACCATGAGAAGAAAACTGCGCAAACACAATTGCCTTCAGAGGAGATGTATGCCTCTCCATTCACGAGTACCCTTTCCCTGA
>human ELABELA ORF:
ATGAGATTTCAGCAATTCCTTTTTGCATTTTTTATTTTTATTATGAGTCTTCTCCTTATCAGCGGACAGAGACCAGTTAATTTGACCATGAGAAGAAAACTGCGCAAACACAATTGCCTTCAGAGGAGATGTATGCCTCTCCATTCACGAGTACCCTTTCCCTGA
Biosynthesis
Biosynthesis
The human ELABELA gene encodes a protein of 54 amino-acids, with a signal peptide in its N-terminal region. It is referenced in Uniprot under PODMC3. After cleavage of the signal peptide which consists of the first 22 residues, the mature ELA hormone is 32 amino-acid long with an isoelectric point exceeding 12. ELA needs to be secreted to become active since deletion of 7 residues in its signal peptide causes a complete loss-of-function in zebrafish. Mature ELA bears 2 conserved di-arginine motifs (R31/R32 and R42/R43) because it is further processed by Furin-like endopeptidase. It is believed that the N-terminal residue of the mature peptide can be substituted by a pyroglutamic acid (Pyr) residue as is the case in endogenous APLN.
The human ELABELA gene encodes a protein of 54 amino-acids, with a signal peptide in its N-terminal region. It is referenced in Uniprot under PODMC3. After cleavage of the signal peptide which consists of the first 22 residues, the mature ELA hormone is 32 amino-acid long with an isoelectric point exceeding 12. ELA needs to be secreted to become active since deletion of 7 residues in its signal peptide causes a complete loss-of-function in zebrafish. Mature ELA bears 2 conserved di-arginine motifs (R31/R32 and R42/R43) because it is further processed by Furin-like endopeptidase. It is believed that the N-terminal residue of the mature peptide can be substituted by a pyroglutamic acid (Pyr) residue as is the case in endogenous APLN.
Phylogeny
Phylogeny
The ELABELA protein is phylogenetically conserved across all vertebrate species with an invariable length of 54 amino acids. Its carboxy terminal end is invariant across species and comprises the signature: -HSRVPFPstop. ELA also contains a pair of conserved cysteines residues at position 39 and 44 that form an intermolecular disulphide bridge.
The ELABELA protein is phylogenetically conserved across all vertebrate species with an invariable length of 54 amino acids. Its carboxy terminal end is invariant across species and comprises the signature: -HSRVPFPstop. ELA also contains a pair of conserved cysteines residues at position 39 and 44 that form an intermolecular disulphide bridge.
A mutant form of ELA with two carboxy missense mutations (p.F53A; p.P54A) acts as an antagonist to APLNR. A mutant form of ELA with two N-terminal missense mutations (p.R31G; p.R32G) can no longer bind to the cell surface of hESCs which express ELA' s alternate receptor.
A mutant form of ELA with two carboxy missense mutations (p.F53A; p.P54A) acts as an antagonist to APLNR. A mutant form of ELA with two N-terminal missense mutations (p.R31G; p.R32G) can no longer bind to the cell surface of hESCs which express ELA' s alternate receptor.
Two Receptors
Two Receptors
ELA is the earliest known endogenous ligand for the cell surface G protein-coupled receptor APLNR (also known as APJ and AGTRL1). The other known ligand for APLNR is the hormonal peptide APELIN. Both ligands have similar binding kinetics to APLNR and can compete for one another suggesting similar binding sites to this GPCR. ELA possesses a second cell surface receptor in hESCs which signals via the PI3K/AKT signalling pathway to mediate hESCs self-renewal. The identity of this second receptor is yet unknown.
ELA is the earliest known endogenous ligand for the cell surface G protein-coupled receptor APLNR (also known as APJ and AGTRL1). The other known ligand for APLNR is the hormonal peptide APELIN. Both ligands have similar binding kinetics to APLNR and can compete for one another suggesting similar binding sites to this GPCR. ELA possesses a second cell surface receptor in hESCs which signals via the PI3K/AKT signalling pathway to mediate hESCs self-renewal. The identity of this second receptor is yet unknown.