Embedded Files
Translation: protein synthesis
Translation: protein synthesis
This section includes the IB topics 2.7 and 7.3:
This section includes the IB topics 2.7 and 7.3:
- The genetic code: codons are triplets of nucleotides in mRNA
- Structure and activation of tRNA
- Structure of the ribosome
- Stages of translation (co-transcriptional translation in prokaryotes)
- Protein structure
- Targeting of mRNA: free vs polysomes (Dr. Pena's Ph.D.)
* * *
* * *
Genetic code
Genetic code
Understanding codes...
Understanding codes...
Dr. Pena's code 1 (simple code)
Below you will find the code-chart of an alphanumerical code that I've created for you (simple code). There are three messages below that need to be decoded... Are you ready?
A) 212114333114212311333212334333111431132334311232132433
B) 212333122111244333322132111131333411144132333122311131132433
C) 411144132333143132244132411212122333122311131132333212334333122311311224433
Dr. Pena's code 2 (complex code)
Would you be able to decode the following messages ("genes")?
1) CAUAAUGGAUGAAAACAAACUAUCUGUUUACAUGGAGAUUUAUAA
2) UUUACUUGAGGUUAUCAAUGAUAUGAUUGAGAAUUUUUAUGAGGUUUAGAUGAA
3) CAUUUAGAACAUCAAGCCUAUCAUGGCGAUUGAUUUGGAGCCUUAUGACAUAAUGGAUGACCUUUAAAUUUAGAU
4) GAAUUUUAUGAUUGAUAUGAUUGAGAAUUUUUAUGAGGAAAUGAAUAUGAUUUAAAUGAUUUAUGAGAUGAACAUGGAAAUGUU
The genetic code
The genetic code
Reading the genetic code
Reading the genetic code
Cells read the code from mRNA, (not from DNA) in the ribosomes. Molecules of transference RNA (tRNA) bring the amino acids into the ribosome and march the codons in the mRNA with the anti-codons (in the tRNA). Enzymes in the ribosome catalyze the formation of peptide bonds between amino acids and a polypeptide is synthesized. The order of the amino acids in the polypeptide (primary structure of the protein) is determined by the mRNA, (which is a copy of a gene). Great chart!
Amino acid codon chart (DNA)
Amino acid codon chart (RNA)
Structure of the ribosome
Structure of the ribosome
The Nobel Prize in Chemistry in 2009 was awarded to Venkatraman Ramakrishnan, Thomas A. Steitz and Ada E. Yonath for their studies of the structure and function of the ribosome.
The ribosome is an organelle that functions as a complex molecular machine in all living cells. Ribosomes condense amino acids together in the order specified by messenger RNA. Each ribosome consists of two subunits, which are made of proteins and ribosomal RNA (rRNA) - which has catalytic activity.
There are two types of ribosomes: prokaryotes have 70S ribosomes and eukaryotes have 80S.
Molecular visualization of the ribosome structure
Molecular visualization of the ribosome structure
The PDB file 4V6X shows the complete structure of a human ribosome. Have a look at the PDB models 1GIY (4V42) and 1JGO which show ribosome and an mRNA moving through the ribosome of T. thermophilus (eubacteria).
Transference RNA (tRNA)
Transference RNA (tRNA)
Structure of the transference RNA
Structure of the transference RNA
tRNA is a special type of RNA that does not code for proteins (made from non-coding DNA). The tRNA molecules fold into a very characteristic cloverleaf structure with 3 loops of between 7 and 8 nucleotides each.
- The amino acid attachment site (3’-CCA) - the base sequence CCA at the 3'
- The anticodon associates with the mRNA codon (via complementary base pairing)
- The T arm associates with the ribosome (via the E, P and A binding sites)
- The D arm interacts with the tRNA activating enzyme during the addition of the amino acid to the amino acid attachment site
Activation of tRNA
Activation of tRNA
tRNA is activated by tRNA activating enzymes which add a specific amino acid to each tRNA.
There are twenty different amino acids and each of them has its specific tRNA (with a different sequence). The attachment of an amino acid to its specific tRNA is catalyzed by very specific enzymes, called tRNA activating enzymes. Twenty different enzymes are needed to attach each of the twenty amino acids to its specific tRNA. The active site of each tRNA activating enzyme is specific for a particular amino acid and for a particular tRNA molecule.
- The tRNA activating enzyme binds to its specific amino acid (active site).
- An ATP is hydrolyzed to AMP and two phosphates are released.
- The AMP molecule binds to the active site.
- The tRNA molecule specific font the amino acid binds to the active site of the enzyme.
- The amino acid binds to the attachment site of the tRNA (3’ end) and AMP is released.
- The activated tRNA with its specific amino acid attached is released from the active site of the enzyme
Translation: synthesis of polypeptides
Translation: synthesis of polypeptides
Steps in translation:
- mRNA binds to the small ribosomal subunit at the mRNA binding site
- The initiator tRNA (with the amino acid methionine bond to it) binds to the start codon: AUG (close to the 5' end of the mRNA)
- The large ribosomal subunit attaches. The initiator tRNA occupies the P site in the assembled ribosome
- Another activated tRNA (with an amino acid attached) enters the ribosome into the A site. The anticodon of the tRNA interacts with the next codon in the mRNA by complementary base pairing in the A site.
- The amino acids in the P and in the A site are condensed together by the enzymatic activity of the rRNA, forming a dipeptide.
- The ribosome moves one three nucleotides along the mRNA (towards the 3' end). The initiator tRNA is released from the E site and the second tRNA occupies the P site. The next codon in the mRNA occupies the A site.
- A new tRNA (with the anticodon complementary to the codon in the A site) brings a new amino acid into the A site. These amino acid is held close together to the previous amino acid and a new peptide bond is formed by condensation (catalyzed by rRNA).
- The ribosome progresses along the mNRA molecule in the 5' to 3' direction, codon by codon. As these steps are repeated a polypeptide emerges from the large subunit.
- When a stop codon (UAA, UAG or UGA) is reached the polypeptide is released into the cytoplasm and the two ribosomal subunits disassemble.
- The polypeptide may be ready to perform a function (protein) or it may need to be folded (tertiary structure) or assembled with other polypeptides (quaternary structure).
Transcription and translation: from genes to proteins (gene expression)
Transcription and translation: from genes to proteins (gene expression)
Watch this video between the minutes 0:30 and 6:30. It is really cool!
Transcription steps (tiny summary from the video):
Transcription steps (tiny summary from the video):
- tRNA activation enzymes - activation of tRNAs
- mRNA binds to the small subunit of the ribosome
- A tRNA with a Methionine amino acid binds to the AUG codon
- The large subunit of the ribosome assembles with the small subunit, the mRNA and the tRNA
- The tRNA holding Methionine is in the P site of the ribosome (APE: Aminocyl, Peptyl and Exit)
- A new tRNA holding another amino acid enters into the A site of the ribosome
- The ribosome moves along the mRNA. A peptide bond is formed in the P site of the ribosome and a tRNA is released in the E site of the ribosome.
- The subunits of the ribosome disassemble in termination.
Class activity: case study - the sound of DNA
Class activity: case study - the sound of DNA
In this case study, music is used as an avenue approach the process of determining protein sequence based on genetic sequence. It follows a the research completed by John Carey in the University of California. He came up with a very creative method to study and explain translation and gene mutations through music. This study connects the topics of transcription (Parts I and II) and gene mutations (Part III). I love this quote their publication: "Explaining science to young people is difficult, but music is universal" —Jeffrey Miller
Case_Study_TheSoundOfDNA.pdfListen to the audio here (Huntington disease).
Read the published article!
Tiny answers here.Protein structure
Protein structure
PRIMARY STRUCTURE:
PRIMARY STRUCTURE:
The sequence and number of amino acids in the polypeptide is the primary structure and it is determined by a sequence of nucleotide bases in a gene. The gene is first transcribed into mRNA and then translated into a polypeptide sequence. The primary structure of the a protein is maintained by covalent peptide bonds between the amino and the carboxyl groups of the amino acids.
SECONDARY STRUCTURE:
SECONDARY STRUCTURE:
The secondary structure is the formation of alpha helices and beta pleated sheets and it is maintained by hydrogen bonding between the NH and the CO groups in the peptide bonds of adjacent amino acids. Peptide bonds are polar covalent bonds. The chain of amino acids tend to fold in a way that hydrogen bonds form between peptide bonds in amino acids located in different parts part of the chain. This results in the formation of patterns within the polypeptide called secondary structures. The alpha helix and the beta pleated sheet are both characteristic foldings (secondary structures).
TERTIARY STRUCTURE:
TERTIARY STRUCTURE:
The tertiary structure is the further folding of the polypeptide by the interactions between R groups in non-adjacent amino acids, often located far away from each other in the polypeptide chain. Tertiary structure confers and overall three-dimensional shape o the protein . As different amino acids have different R-group with different properties, there are several types o interactions that maintain the tertiary structure of a protein:
- Amino acids with electrically charged R-groups: positively charged R-groups tend to interact with negatively charged R-groups.
- Amino acids with polar (uncharged) R-groups tend to form hydrogen bonds with other polar R-groups in different amino acids.
- Amino acids with hydrophobic R-groups: amino acids tend to avoid contact with water and orientate themselves towards the centre o the polypeptide.
- The R-group o the amino acid cysteine can form covalent bonds with the R-group o another cysteine. These is the strongest possible bond in a tertiary structure and it is called a disulphide bond.
QUATERNARY STRUCTURE:
QUATERNARY STRUCTURE:
By definition, a protein is a functional molecule. Some proteins are made from one polypeptide chain, like the enzyme lysozyme. Other proteins require the assembly of more that one polypeptide to become functional. Hemoglobin is a protein made of four polypeptides (called subunits). Quaternary structure refers to the way polypeptides fit together when there is more than one chain. Only proteins that are made by more than one subunit (polypeptide chain) have quaternary structure.
Targeting of mRNA
Targeting of mRNA
Where in the cytoplasm will the mRNA go?
Where in the cytoplasm will the mRNA go?
Translation takes place in the ribosomes in the cytoplasm. As you may remember from Unit 1, ribosomes can be found either freely floating in the cytosol or bound together in clusters called polysomes (in the rough ER in eukaryotes).
A polysome is a cluster of ribosomes held together by a strand of messenger RNA that each ribosome is translating. Polysomes synthesize proteins primarily for secretion or for use in lysosomes. Proteins that are needed in large quantity such as those used in the ER, the Golgi apparatus, lysosomes, the plasma membrane or outside the cell are synthesized by ribosomes bound to the ER.
Free ribosomes synthesize proteins or use primarily within the cell, such as those used in the cytoplasm, mitochondria and chloroplasts.
*** Other resources ***
*** Other resources ***
Worksheet 7.3 translation.pdfTiny answers
1 Uracil replaces thymine in RNA (and is complementary to adenine) 2 Met – Tyr – Gly – Gly – Phe – Leu – Arg – Lys – Tyr – Pro – Lys (Stop) 3 The genetic code is degenerate / several codons can code for the same amino acid / the same amino acid sequence (in an oligopeptide) can result from different base sequences (in the gene coding for that peptide) 4 Initiator Met residue is post-translationally cleaved from the peptide (to give a mature peptide)Tiny answers
Vocabluary_7.3.pdfWorksheet_7.3.pdfSome of these Quizlets have NOT been done by me, but it seems to be mostly correct. If you find any mistake please let me know!
7.3 Translation.pdfReport abuse