Embedded Files
Synthesis of DNA
Synthesis of DNA
This section includes the IB topics 2.7 and 7.1:
This section includes the IB topics 2.7 and 7.1:
- Enzymes involved in DNA elongation (leading and lagging strands)
- Tsuneko and Reiji Okazaki: replication in the lagging strand.
- Hershey and Chase: DNA is the genetic material.
- Meselson–Stahl: semiconservative replication
- Kary Mullis: PCR and Taq DNA polymerase (the DNA copy machine)
- Frederick Sanger: DNA sequencing with nucleotides containing dideoxyribonucleic acid
Enzymes involved in DNA replication:
Enzymes involved in DNA replication:
Helicase separates the DNA strands and creates a replication fork
Topoisomerase cuts the double strand of DNA to reduce the strain created by the unwinding of the helix ahead of the replication fork.
Leading strand (replication happens towards the replication fork)
Primase adds the RNA primer (5 to 10 nucleotides long) and marks the origin of replication (multiple in each DNA strand)
DNA polymerase III attaches to the DNA with the primer
DNA polymerase III moves in the template DNA strand towards the 5’ (3’->5’)
DNA polymerases can only add nucleotides to the 3’ because they require the OH group on 3’
The new DNA strand that is being created grows in a 5’ to 3’ direction
Exonuclease removes the RNA nucleotides of the primer
DNA polymerase I replaces the primer RNA for DNA
Ligase joins the DNA fragments to form a continuous strand
Lagging strand (replication happens away from the replication fork)
Primase adds the RNA primer
DNA polymerase III attaches to the DNA with the primer
DNA polymerase III moves in the template DNA strand towards the 5’ (3’->5’) - farther from helicase
DNA is synthesized in okazaki fragments (100-200 nucleotides long). Each okazaki fragment requires its own RNA primer!
DNA replication activity:
DNA replication activity:
Introduction:
Introduction:
In genetics, a sense strand, or coding strand, is the segment within double-stranded DNA that runs from 5' to 3', and which is complementary to the antisense strand of DNA, or template strand, which runs from 3' to 5'.
DNA molecule
DNA molecule
(sense strand sequence made of 96 bases in a paper sting 960 cm long).
5’ATGAGGCTAGCTATGCATTACGCATGCGTAGCGATCGTCATTGATGTTCGAAGCGAATCGAATCGCGCCCCCCGAATCATGTCATGCGTATCGTAG3’
Rules:
Rules:
- Maximum two replication forks
- Okazaki fragments are 5 nucleotides long: helicase moves 5 nucleotides, wait until both strands are copied, then move another 5, etc.
The Okazaki experiment:
The Okazaki experiment:
Meselson and Stahl: Semiconservative replication of DNA
Meselson and Stahl: Semiconservative replication of DNA
The most beautiful experiment in Biology...
In May 1958 Meselson–Stahl and published the experiment that demonstrated the semi-conservative replication of DNA. Watch the minute 2.45 in this video and learn about the 3 theories of DNA replication and the discovery of the semiconservative replication.
PCR (Polymerase Chain Reaction)
PCR (Polymerase Chain Reaction)
DNA sequencing through termination of replication (Sanger)
DNA sequencing through termination of replication (Sanger)
Read more about Frederick Sanger here.
Amazing DNA experiments: class activity (stations)
Amazing DNA experiments: class activity (stations)
Nucleic acids are extremely thin and long molecules and it has taken a huge amount of time and effort from many scientists in different countries to fully understand how is it made and how is it replicated. In this activity, the class will be divided in five groups that will move through five stations. Each station presents one amazing experiment that helped us to understanding DNA structure and replication. All these experiments were completed between 1952 and 1993 in different countries and led to multiple Nobel prizes!.
7.1 DNA Replication.pdfReport abuse