dsRNA Google Scholar 2010 Results 1 - 100 of about 339 6/2/10
double-stranded RNA (dsRNA)
ssRNA Google Scholar 2010 Results 1 - 93 of 93.
Mutations abrogating VP35 interaction with dsRNA render Ebola virus avirulent in …
KC Prins, S Delpeut, DW Leung, O Reynard, … - Journal of …, 2010 - Am Soc Microbiol
Kathleen C. Prins1†, Sebastien Delpeut2,3,4,5† Daisy W. Leung6, Olivier Reynard2,3,4,5, Valentina
A. Volchkova2,3,4,5, St. Patrick Reid1,2,3,4,5, Parameshwaran Ramanan6,7 ... Cárdenas8,
Gaya K. Amarasinghe6, Viktor E. Volchkov2,3,4,5* and Christopher F. Basler1*
A Role for p38 Stress-Activated Protein Kinase in Regulation of Cell Growth via …
M Cully, A Genevet, P Warne, C Treins, T … - … and Cellular Biology, 2010 - Am Soc Microbiol
... Primer sequences for dsRNA. ... RNAi molecules were generated as described previously (73).
S2 cells were plated in serum-free medium and incubated with dsRNA. Serum-containing
medium was added after 1 h. Cells were harvested after five days. ...
… Negatively Affects Maintenance of the Endogenous dsRNA Virus, Oryza sativa …
S Urayama, H Moriyama, N Aoki, Y … - Plant and Cell …, 2010 - Jpn Soc Plant Physiol
An endogenous double-stranded RNA (dsRNA), which has recently been recognized as the
dsRNA virus Oryza sativa endornavirus (OsEV), is found in many strains of cultivated rice (Oryza
sativa). Small RNAs derived from OsEV dsRNA were detected, indicating that the RNA ...
… : Gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNAbiomedcentral.com [PDF]
S Karim, E Troiano, TN Mather - BMC biotechnology, 2010 - biomedcentral.com
... Functional genomics tool: Gene silencing in Ixodes scapularis eggs and nymphs by electroporated
dsRNA BMC Biotechnology 2010, 10:1 doi:10.1186/1472-6750-10-1 ... nymphs by electroporated
dsRNA Shahid Karim1§, Emily Troiano2 and Thomas N. Mather2 ...
Ebolavirus VP35 uses a bimodal strategy to bind dsRNA for innate immune …
CR Kimberlin, ZA Bornholdt, S Li, VL … - Proceedings of the …, 2010 - National Acad Sciences
Ebolavirus causes a severe hemorrhagic fever and is divided into five distinct species, of which
Reston ebolavirus is uniquely nonpathogenic to humans. Disease caused by ebolavirus is marked
by early immunosuppression of innate immune signaling events, involving silencing and ...
… -killing of melanoma cells by cytosolic delivery of dsRNA: Wiring innate immunity …
D Alonso-Curbelo, MS Soengas - Autophagy, 2010 - ncbi.nlm.nih.gov
Patients with metastatic melanoma have a poor prognosis, primarily due to a generalized inefficacy
of current anticancer treatments. Therefore, the identification of novel death inducers with good
bioavailability and safety profiles is a main priority in this disease. Here we summarize ...
Structural basis for dsRNA recognition and interferon antagonism by Ebola VP35
DW Leung, KC Prins, DM Borek, M … - Nature Structural & …, 2010 - nature.com
Ebola viral protein 35 (VP35), encoded by the highly pathogenic Ebola virus, facilitates host immune
evasion by antagonizing antiviral signaling pathways, including those initiated by RIG-I–like
receptors. Here we report the crystal structure of the Ebola VP35 interferon inhibitory ...
Mechanism of activation of dsRNA-dependent protein kinase (PKR) in muscle …
HL Eley, ST Russell, MJ Tisdale - Cellular signalling, 2010 - ncbi.nlm.nih.gov
The role of Ca(2+) in the activation of PKR (double-stranded-RNA-dependent protein
kinase), which leads to skeletal muscle atrophy, has been investigated in murine myotubes using
the cell-permeable Ca(2+) chelator BAPTA/AM (1,2-bis (o-aminphenoxy) ethane-N,N,N',N' ...
Optimized Methods For Delivery Of DSRNA Targeting The PCSK9 Gene
K Fitzgerald, A De Fougerolles, A Akinc, VE Kotelianski - 2010 - freepatentsonline.com
1. A method for inhibiting expression of a PCSK9 gene in a subject, the method comprising administering
a first dose of a dsRNA targeted to the PCSK9 gene and after a time interval optionally administering
a second dose of the dsRNA wherein the time interval is not less than 7 days.
USE OF SIRNA TO ACHIEVE DOWN REGULATION OF AN ENDOGENOUS GENE …
RS Dondero, JE Thompson, CA Taylor - 2010 - freepatentsonline.com
... BACKGROUND OF THE INVENTION. Relatively recently, researchers observed that double
stranded RNA (“dsRNA”) could be used to inhibit protein expression. ... Initial attempts to use RNAi
in mammalian cells focused on the use of long strands of dsRNA. ...
Activation of immune-associated phospholipase A2 is functionally linked to Toll/Imd …
S Shrestha, Y Kim - Developmental & Comparative Immunology, 2010 - Elsevier
... The activation of PLA 2 via Toll and Imd pathways could be explained by induction of PLA
2 gene expression because the dsRNA treatments of Toll and Imd genes suppressed the
gene expression of PLA 2 in response to bacterial challenge. ...
Incidence of endornaviruses in Phytophthora taxon douglasfir and Phytophthora …
Z Kozlakidis, NA Brown, A Jamal, X Phoon, RHA Coutts - Virus Genes, 2010 - Springer
... Three endornavirus- specific RT–PCR amplicons were generated by RT–PCR using dsRNA
isolated from the four Phytophthora taxon douglasfir isolates and one representative Phytophthora
ramorum isolate as template with oligonucleotide primers designed from the ...
Lactobacillus-mediated RNA interference in nematode
A Kuwahara, M Arita, A Kushiro, Y Sakube, M … - Journal of Bioscience …, 2010 - Elsevier
... We engineered Lactobacillus paracasei to produce a dsRNA that would trigger RNAi-induced
silencing of an essential gene in the nematode Caenorhabditis elegans. ... Key words: RNAi; dsRNA;
Lactobacillus paracasei; Lactic acid bacteria; Caenorhabditis elegans; Nematode. ...
A label-free electrochemical RNA aptamer for selective detection of theophylline
GC Zhao, X Yang - Electrochemistry Communications, 2010 - Elsevier
... Then, the complement stranded RNA, which can combine with the probe ssRNA to form a
double-stranded RNA (dsRNA) with a recognition unit of theophylline, was linked on the
probe RNA through a hybrid reaction in the presence of theophylline. ...
Small RNA Diversity in Plants and its Impact in Development
C Lelandais-Briere, C Sorin, M Declerck, A … - Current …, 2010 - ingentaconnect.com
... 2. SMALL RNAs BIOGENESIS AND mRNA TARGET REGULATION The origin of endogenous
small RNAs differs as siRNAs are generated from long intermolecular double strand RNAs
(dsRNA) whereas miRNAs are produced from intramolecular dsRNAs. ...
Recognition of viruses by cytoplasmic sensors
C Wilkins, M Gale Jr - Current Opinion in Immunology, 2010 - Elsevier
... and negative stranded viruses (including Hepatitis C virus, respiratory syncytial virus and related
paramyxoviruses, vesicular stomatitis virus and influenza A virus), MDA5 is responsible for the
recognition of picornaviruses and is the primary sensor of the dsRNA mimetic poly(I:C ...
Taming of the shrewd: novel eukaryotic genes from RNA virusesbiomedcentral.com [PDF]
EV Koonin - BMC biology, 2010 - biomedcentral.com
... The work of Taylor and Bruenn [1] extends the results of Frank and Wolfe through a detailed
characterization of NIRV derived from a specific family of dsRNA viruses ... integration of dsRNA
viral genomes into the fungal genomes by polymerase chain reaction ...
The Toll immune signaling pathway control conserved anti-dengue defenses …
JL Ramirez, G Dimopoulos - Developmental & Comparative Immunology, 2010 - Elsevier
... Synthesis of dsRNA was performed using the T7 Megascript kit (Ambion) and the following
primers: for Cactus dsRNA synthesis: Cactus_F: TAATACGACTCACTATAGGG
CGAGTCAACAGAACCCGAGCAG, Cactus_R: TAATACGACTCACTATAGGG ...
RNAi for functional genomics in plants
KM McGinnis - Briefings in Functional Genomics and …, 2010 - Oxford Univ Press
... RNAi refers to several different types of gene silencing mediated by small, dsRNA
molecules. Over the course of 20 ... resulting phenotype can be studied. TECHNIQUES
FOR INDUCING dsRNA-MEDIATED SILENCING IN PLANTS. ...
The intellectual property landscape for gene suppression technologies in plants
CL Chi-Ham, KL Clark, AB Bennett - Nature Biotechnology, 2010 - nature.com
... expression. RNA interference. The term 'RNA interference' was coined in 1998 by Nobel
laureates Fire, Mello and colleagues to describe a gene-silencing phenomenon induced
by double-stranded RNA (dsRNA) 14 . The mechanism ...
J Hughes, P Yadava, R Mesaros - Methods in molecular biology (Clifton, …, 2010 - Springer
... A number of technologies offer the poten- tial for specific therapeutic gene silencing. One
such technology, that was discovered relatively recently and is believed to be very potent
and specific, is mediated by double-stranded RNA (dsRNA). ...
A Method to Discover Phased siRNA Loci.
MJ Axtell - Methods in molecular biology (Clifton, NJ), 2010 - Springer
... Michael J. Axtell Abstract Short, interfering RNAs (siRNAs) arise from the processing of long
double-stranded RNA (dsRNA) by Dicer enzymes. ... Therefore, a population of dsRNAs with
precisely identical termini will produce siRNA spaced in regular, 21–24-nucleotide intervals. ...
LGP2: Positive about viral sensing
EMY Moresco, B Beutler - Proceedings of the National …, 2010 - National Acad Sciences
... Fig. 1. Model for LGP2 function in potentiating RIG-I and MDA5 antiviral signaling.
Upon infection with an RNA virus, viral dsRNA or 5′-triphosphorylated RNA can
activate RIG-I or MDA5 by binding to their CTDs. LGP2, as ...
LGP2 is a positive regulator of RIG-I–and MDA5-mediated antiviral responses
T Satoh, H Kato, Y Kumagai, M … - Proceedings of the …, 2010 - National Acad Sciences
... RIG-I is also reported to be involved in the recognition of foreign DNA in the cytoplasm through
transcription of the DNA to dsRNA by polymerase III (12, 13). ... A recent report proposed that the
RIG-I ATPase activity is required for translocation of RIG-I on dsRNA (15). ...
Additive effects of plant expressed double-stranded RNAs on root-knot nematode …
WL Charlton, HY Harel, M Bakhetia, JK … - International journal …, 2010 - ncbi.nlm.nih.gov
... Expression of processed dsRNA was observed, but no evidence of detectable levels
of small interfering RNAs (siRNAs) was found in the transgenic plants. We show,
to our knowledge for the first time, that combining expression ...
Virus discovery by deep sequencing and assembly of virus-derived small silencing …
Q Wu, Y Luo, R Lu, N Lau, EC Lai, … - Proceedings of the …, 2010 - National Acad Sciences
... To test this idea, we examined contigs assembled from published small RNA libraries and
discovered five previously undescribed viruses from cultured Drosophila cells and adult
mosquitoes, including three with a positive-strand RNA genome and two with a dsRNA genome. ...
Hairpin RNA induces secondary small interfering RNA synthesis and silencing in …
F Simmer, A Buscaino, IC Kos-Braun, A Kagansky, A … - EMBO reports, 2010 - nature.com
... Exogenous double-stranded RNA (dsRNA) triggers seem to induce heterochromatin formation
in trans only when certain silencing proteins are overexpressed. ... Non-coding transcripts derived
from repetitive elements form dsRNA and are processed into siRNAs by Dcr1. ...
Delivery of RNA interference triggers to sensory neurons in vivo using herpes …
AM Anesti, RS Coffin - Expert Opinion on Biological …, 2010 - informahealthcare.com
... were using antisense RNA to inhibit par-1 mRNA expression, when they discovered that the sense
RNA strand also repressed expression of par-1 [1]. Subsequently, Fire and Mello demonstrated
in their Nobel Prize winning study that double-stranded RNA (dsRNA) formed by ...
RNAi at work: Targeting invertebrate pests and beneficial organisms' diseases
E Ben-Chanoch, JD Ellis, E Glick, WB Hunter … - Plant and Animal …, 2010 - ars.usda.gov
... Beeologics (www.beeologics.com) has established a simple and relatively
inexpensive procedure to produce large quantities of dsRNA vaccine-like, to target
pest or pathogen sequences. Remebee is the company"s leading ...
Identification and characterization of Rhipicephalus (Boophilus) microplus …nih.gov [HTML]
C Almazán, R Lagunes, M Villar, M Canales, R … - Parasitology …, 2010 - Springer
... D8BMT75: 5′-TAATACGACTCACTATAGGGTACTGACT GGGACCCCTTGCACAGT-3′ and
D8BMT73 5′-TAATAC GACTCACTATAGGGTACTCGAGTTTGGTAGATAG CACA-3) were
synthesized and used for in vitro transcrip- tion of double-stranded RNA (dsRNA) using the ...
RIGorous Detection: Exposing Virus Through RNA Sensing
J Rehwinkel, R e Sousa… - Science, 2010 - scienceonline.org
... Page 3. ular sequences, or the annealing of two comple- mentary RNA strands so as to form
double-stranded RNA (dsRNA). ... It is worth remembering that base-paired does not mean
double-stranded; by definition, dsRNA requires two (complementary) RNA molecules. ...
Beyond Drosophila: RNAi In Vivo and Functional Genomics in Insects
X Bellés - Annu. Rev. Entomol, 2010 - Annual Reviews
... This paradoxical result was subsequently explained by the experiments of Fire, Mello
and coworkers (21), who carefully purified the RNA antisense, RNA sense, and
double-stranded RNA (dsRNA) for the gene unc-22 of C. elegans. ...
[PDF] Duplication and functional diversification of pancreatic ribonuclease ( …scichina.com [PDF]
XY Wang, NZ Li, L Yu… - Chinese Sci Bull, 2010 - scichina.com
... Pancreatic RNases of many mammals are also found to be expressed outside the pancreas
[44] and have an activity in degrading double stranded RNA (dsRNA) [45]. This activity is thought
to be involved in the host de- fense against dsRNA viruses [46,47]. ...
Molecular mechanisms that funnel RNA precursors into endogenous small- …
K Miyoshi, T Miyoshi, JV Hartig, H Siomi, MC Siomi - RNA, 2010 - rnajournal.cshlp.org
... The Dicer2–Loqs-PD complex also contained R2D2 and thus showed an ability to process
long dsRNAs into siRNAs in vitro. ... A pre- vious study showed that Dicer1 interacts strongly
with the third dsRNA-binding domain of Loqs-PB (Ye et al. 2007). ...
Segment-2 sequence analysis and cross-neutralization studies on some Indian …
PA Tembhurne, B Mondal, KB Pathak, SK Biswas, A … - Archives of …, 2010 - Springer
... major outer capsid protein VP2 [31]. The virus is double-shelled and has a segmented
double- stranded RNA (dsRNA) genome consisting of ten segments that code for
ten distinct viral proteins. The inner layer forming the 'core ...
RNAi Applications to Defeat Respiratory Viral Infections
S Barik - RNA Interference and Viruses: Current Innovations and …, 2010 - books.google.com
... Introduction: the antiviral basis of RNAi RNA interference (RNAi) is a natural cellular
pathway, evolutionarily conserved in essentially in all metazoans and triggered by
double-stranded RNA (dsRNA)(Fire et al., 1998; Mello et al., 2004). ...
Loss of function of the influenza A virus NS1 protein promotes apoptosis but this is …
D Jackson, MJ Killip, CS Galloway, RJ Russell, RE … - Virology, 2010 - Elsevier
... Available online 31 October 2009. Abstract. A panel of influenza A viruses encoding
mutant NS1 proteins was created in which a number of NS1 functions, including
interactions with dsRNA, PI3K, CPSF30 and PKR, were inhibited. ...
[HTML] RNAa Is Conserved in Mammalian Cellsnih.gov [HTML]
V Huang, Y Qin, J Wang, X Wang… - 2010 - ncbi.nlm.nih.gov
... dsRNA Design. Promoter sequences for all primates were retrieved from Ensembl genome
databases (www.ensembl.org) and analyzed against several genome and sequence databases
including dbTSS (Database of Transcriptional Start Sites, http://dbtss.hgc.jp), AceView ...
Analysis of Monomeric and Dimeric Phosphorylated Forms of Protein Kinase R
E Anderson, C Quartararo, RS Brown, Y Shi, X Yao, JL … - 2010 - pubs.acs.org
... immunity antiviral pathway. Upon binding double-stranded RNA (dsRNA) or
dimerization in the absence of dsRNA, PKR undergoes autophosphorylation at
multiple serines and threonines that activate the kinase. Although it ...
Identification of an RNA-dependent RNA polymerase in Drosophila establishes a …
C Lipardi, BM Paterson - Fly, 2010 - ncbi.nlm.nih.gov
... Remarkably, even though robust RNA silencing occurs in Drosophila in response to exogenous
dsRNA and siRNAs, no RdRP homolog has been identified in the Drosophila genome or in any
other higher eukaryote characteristic of the known cellular RdRPs. ...
An ascovirus encoded ribonuclease III autoregulates its expression and …
M Hussain, AM Abraham, S Asgari - Journal of Virology, 2010 - Am Soc Microbiol
... protein after infection and demonstrated dsRNA specific endoribonuclease activity of the 9
encoded protein. ... Page 3. 3 Introduction 17 Ribonucleases III (RNase III) are dsRNA specific
processing enzymes present in prokaryotes, 18 eukaryotes and in some viruses. ...
The Possible Use of Terpene Compounds in DC Immunotherapy against Cancer
M Takei, A Umeyama, JJ Lee - Recent Patents on Endocrine, …, 2010 - ingentaconnect.com
... derived DC matured by either poly I:C, dsRNA, interferon- alpha (IFN-α), tumor necrosis
factor-alpha (TNF-α), LPS, TLR ligands (R848, dsRNA) or cytokine cocktail in vitro
produce high levels of IL-12 and induce Th1 cells [10-12]. ...
Modulation of Chromatin Boundary Activities by Nucleosome-Remodeling …
M Li, VE Belozerov, HN Cai - Molecular and Cellular Biology, 2010 - Am Soc Microbiol
... Cell culture insulator assay, RNAi, and qRT-PCR. Construction of the transgenes used in the
cell-based enhancer-blocking assay, S2 cell culture and transfection, and double-stranded
RNA (dsRNA) treatment procedures were as described previously (52). ...
[HTML] Intrinsic Cellular Defenses against Virus Infection by Antiviral Type I …nih.gov [HTML]
KH Boo, JS Yang - 2010 - ncbi.nlm.nih.gov
... Especially, viral double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), unmethylated
CpG motif and outer structural proteins stimulate intrinsic cellular defenses and further innate
immune response 1 - 5 (Fig. 1 Fig. ... TLR3 recognizes viral dsRNA, TLR2 and (more ...). ...
Both RIG-I and MDA5 RNA Helicases Contribute to the Induction of Alpha/Beta …
S Ikegame, M Takeda, S Ohno, Y Nakatsu, Y … - The Journal of …, 2010 - jvi.highwire.org
... Using the dsRNA-specific antibody J2 (55), we tried to detect intracellular dsRNA, which is the
ligand for MDA5 (22). Although dsRNA was not found in wt MV- or MV V-infected Vero/hSLAM
cells, it was clearly detected in MV C-infected cells (data not shown). ...
Direct Force Measurements on Double-Stranded RNA in Solid-State Nanoporestudelft.nl [PDF]
M van den Hout, ID Vilfan, S Hage, NH Dekker - 2010 - pubs.acs.org
... Here, we demonstrate the first application of such a system to the study of RNA by
directly measuring the net force on individual double-stranded RNA (dsRNA)
molecules. We have probed the force on dsRNA over a large range ...
Effects of chemical modification on the potency, serum stability, and …
Q Ge, A Dallas, H Ilves, J Shorenstein, MA Behlke, BH … - RNA, 2010 - rnajournal.cshlp.org
... INTRODUCTION. RNA interference (RNAi) is an evolutionarily conserved, highly specific
pathway whereby double-stranded RNA (dsRNA) causes sequence-specific inhibition of gene
expression. ... dsRNA-induced innate immune response in 293FT cells. ...
Stepwise translocation of nucleic acid motors
S Myong, T Ha - Current Opinion in Structural Biology, 2010 - Elsevier
... Recently, we discovered that RIG-I, an antiviral sensor and an ATPase is a robust translocase
on double stranded RNA (dsRNA) [14 •• ]. RIG-I recognizes and binds dsRNA of viruses as
a pathogenic signature and elicits an antiviral signaling cascade. ...
Intended transcriptional silencing with siRNA results in gene repression through …
J Moses, A Goodchild, LP Rivory - RNA, 2010 - rnajournal.cshlp.org
... experiment; (*) p < 0.05. Critical sequence requirements for dsRNA targeting the
VEGF promoter. The sequence ... anti-promoter functionality. dsRNA-mediated inhibition
is not through specific targeting of promoters. To establish ...
Subversion of Interferon by Dengue Virus
JL Muñoz-Jordán - Current topics in microbiology and immunology, 2010 - Springer
... B IRAK1 IRAK4 TIR TRIF TLR3 dsRNA STAT1 STAT2 IRF9 TRAF6 IKB IKK1 TBK1 ... (b)TLR3, a
broad sensor of dsRNA intermediates during viral infections, is upregulated in human umbilical
endothelial cells (HUVEC) by DENV infection. IRF3 leads to activation of IFNb. ...
Related articles - All 3 versions
[PDF] Chronic Hepatitis C: Pathophysiology, Diagnosis and Treatment Optionsmizpahpublishing.org [PDF]
TAVSE Estrabauda, P Marcellina - Front Gastrointest Res, 2010 - mizpahpublishing.org
... It should be remem- bered that the dsRNA virus induces host immune response; dsRNA is
recognized as a pathogen-associated molecular pattern by pattern recognition receptors such
as endosomal Toll-like receptor 3 (TLR-3) and cytosolic retinoic acid-inducible gene-I (RIG-I ...
Related articles - View as HTML
Role of DREF in transcriptional regulation of the Drosophila p53 gene
N Trong-Tue, DTP Thao, M Yamaguchi - Oncogene, 2010 - nature.com
... Reduction of DREF protein in DREF– double-stranded RNA (dsRNA)-treated cells was
confirmed by western immunoblot analyses with anti-DREF antibodies (Figure 6a). ...
DREF–dsRNA treatment effects on mRNA levels and promoter activities of dmp53. ...
A Genome-wide RNAi Screen for Modifiers of Aggregates Formation by Mutant …flyrnai.org [PDF]
S Zhang, R Binari, R Zhou, N Perrimon - Genetics, 2010 - Genetics Soc America
... With the recent advent of RNAi technology and the development of genome-wide dsRNA libraries,
it is possible to quickly and systematically ... for a modifier screen, we treated these cells with a dsRNA
against dhdj1, a known suppressor of aggregates (CHAN et al. ...
Influenza Antiviral Therapeutics (Supplementry Material)
AL Mayburd - Recent Patents on Anti-Infective Drug Discovery, 2010 - ingentaconnect.com
... Such a program involves activation of dsRNA cleavage (typically viruses express
or form dsRNA during infection), activation of antigen presentation, immune cell
mobilization and suppression of protein and nucleic syn- thesis. ...
ISG15 conjugation system targets the viral NS1 protein in influenza A virus– …
C Zhao, TY Hsiang, RL Kuo, RM … - Proceedings of the …, 2010 - National Acad Sciences
... function. interferon | antiviral | dsRNA | Herc5 | importin-α ... The RBD domain of NS1A
protein binds double- stranded RNA (dsRNA) (17–19) and also contains a nuclear
localization signal (NLS) that binds importin-α (20). We ...
The C-terminal residues of the 2b protein of Cucumber mosaic virus are important …
K Sueda, H Shimura, A Meguro, T Uchida, J Inaba, C … - FEBS letters, 2010 - Elsevier
... Furthermore, cucumovirus 2b can bind to small RNAs [11] and [12], suggesting that
2b inhibits RNA silencing by binding to double-stranded RNA (dsRNA) and
short-interfering RNA (siRNA), which trigger the RNA silencing pathway. ...
Analyzing the Effects of Delaying Aster Separation on Furrow Formation during …
L Lewellyn, J Dumont, A Desai, K … - Molecular Biology of the …, 2010 - Am Soc Cell Biol
... L4 hermaphrodites were injected with dsRNA and incubated at 20°C for 45–48 h. For
double depletions, RNAs were mixed to obtain equal concentrations for each RNA.
For single depletions done in parallel with double depletions ...
Porcine Reproductive and Respiratory Syndrome Virus Nonstructural Protein 1 { …
LK Beura, SN Sarkar, B Kwon, S … - The Journal of …, 2010 - jvi.highwire.org
... All of three proteins, when expressed stably in cell lines, strongly inhibited double-stranded
RNA (dsRNA) signaling pathways. NSP1β was found to inhibit both IFN regulatory factor 3
(IRF3)- and NF- B-dependent gene induction by dsRNA and Sendai virus. ...
V Hornung, E Latz - Nature Reviews Immunology, 2010 - nature.com
... is a crucial factor that induces type I IFN production. Viral double-stranded RNA
(dsRNA) functions as a molecular structure that signals the presence of non-self
to the host. However, in some of these early studies, it was also ...
The NS1 Protein of Influenza A Virus
C Zhao, RL Kuo, RM Krug - Influenza: Molecular Virology, 2010 - books.google.com
... A major role of the NS1 protein is to counter host cell antiviral responses. Thus, the RNA-binding
domain binds double-stranded (ds) RNA, thereby inhibiting the dsRNA activation of the antiviral
oligo A synthetase/RNase L pathway that is induced by interferon-α/β (IFN-α/β). ...
COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF GSK-3 …
D SAH, G HINKLE - WO Patent WO/2010/006,342, 2010 - wipo.int
... 3 GENES. Abstract: The invention relates to a double-stranded ribonucleic acid
(dsRNA) targeting Glycogen Synthase Kinase-3 (GSK-3), and methods of using the
dsRNA to inhibit expression of GSK-3. Designated States: AE ...
Processing of miRNA Precursors.
Y Kurihara, Y Watanabe - Methods in molecular biology (Clifton, NJ), 2010 - Springer
... 1) (3). Drosha functions as a com- plex with the double-stranded RNA (dsRNA)-binding protein
DGCR8 (also known as Pasha) (4–7). The reaction eliminates the nonpairing sequences and
releases specific panhandle-structured intermediates that are referred to as pre-miRNAs ...
Overcoming Multidrug Resistance by RNA Interference.
A Stege, A Krühn, H Lage - Methods in molecular biology (Clifton, NJ), 2010 - Springer
... The RNAi pathway (detailed over- views of the biochemical features of RNAi in (4–6)) is
initiated by processing of long regulatory double-stranded RNA (dsRNA) into approximately
21–28 nt siRNAs by Dicer, a endoribonu- clease-III-like enzyme. ...
Phosphorylation-mediated negative regulation of RIG-I anti-viral activity
MU Gack, E Nistal-Villan, KS Inn, A Garcia- … - Journal of …, 2010 - Am Soc Microbiol
... of most non- 33 immune cells (4, 28, 31, 32). RIG-I is activated by different types
of viral RNA, such as 34 5'triphosphate single-stranded RNA and dsRNA while MDA5
is activated by dsRNA (12, 23, 35 32). In line with this, the ...
O Voinnet - Nature Reviews Molecular Cell Biology, 2010 - nature.com
... The first paper, by Bernstein et al., establishes that dsRNA is processed into small (~ 20 nucleotide)
RNAs by an RNase III enzyme called Dicer. ... “the 'Hannon trilogy' — ...all you need to know to
understand how dsRNA directs the sequence-specific inhibition of gene expression”. ...
W Wong - Science Signaling, 2010 - sciencesignaling.org
... The authors found that transfection of double-stranded RNA (dsRNA) in S2R + cells to knock
down the cyclin-dependent kinase (CDK)–like protein L63 decreased phosphorylation at Ser
1490 and Thr 1479 of LRP6 (detected by immunoblotting with phosphorylation site ...
COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TGF-BETA …
B BRAMLAGE, M HOSSBACH, P TAN, HP … - WO Patent WO/2010/ …, 2010 - wipo.int
... Abstract: The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the
expression of a TGF-beta receptor type I gene, comprising an antisense strand having a nucleotide
sequence which is less than 30 nucleotides in length and which is substantially ...
Crystal Structure of an Aquabirnavirus Particle: Insights into Antigenic Diversity and …
F Coulibaly, C Chevalier, B Delmas, FA Rey - Journal of Virology, 2010 - Am Soc Microbiol
... Birnaviruses form a distinct family of double-stranded RNA (dsRNA) viruses infecting
vertebrates and invertebrates (18). Aquatic birnaviruses are ... RNA (19). The birnavirus
genome consists of two segments of dsRNA. While ...
Absence of SHIP-1 Results in Constitutive Phosphorylation of Tank-Binding Kinase …
JN Gabhann, R Higgs, K Brennan, W … - The Journal of …, 2010 - Am Assoc Immnol
... (TLR3, TLR7/8, and TLR9) constitute a subset of TLRs that have evolved to recognize viral nucleic
acids (dsRNA, ssRNA, and ssDNA, respectively) and, in doing so, drive the expression of IFNs
and proinflammatory cytokines to combat the infection (reviewed in Ref. ...
Dcr1 Tracked Downcell.com [HTML]
LJT Kaaij, RF Ketting - Developmental Cell, 2010 - Elsevier
... siRNAs are processed from long dsRNA molecules by dicer, an evolutionary well-conserved
RNaseIII-like ribonuclease, containing additional functionalities like a helicase domain and two
RNA binding domains: PAZ (Piwi Argonaute Zwille) and dsRBD (double-strand RNA ...
Interference RNA for in vivo Knock-down of gene expression or genome-wide …
S Petit, K Thiam - Methods in molecular biology (Clifton, NJ), 2010 - Springer
... RNAi is a sequence-specific posttranscriptional gene silencing (PTGS) mechanism. It is triggered
by double stranded RNA (dsRNA), an important signaling molecule in eukaryotic cells enabling
the break down of mRNAs that are homologous in sequence to itself. ...
Regulation of Adaptive Immunity by the Innate Immune System
A Iwasaki, R Medzhitov - Science, 2010 - sciencemag.org
... of Gram-negative bacteria (TLR4), lipoteichoic acids of Gram-positive bacteria and bacterial
lipoproteins (TLR1/TLR2 and TLR2/TLR6), and flagellin (TLR5), whereas endosomal TLRs mainly
detect microbial nucleic acids, such as double-stranded RNA (dsRNA) (TLR3), single ...
[PDF] Characterization of RNase HII substrate recognition using RNase HII– …biochemj.org [PDF]
S Kitamura, K Fujishima, A Sato, D Tsuchiya, … - The Biochemical …, 2010 - biochemj.org
... Abbreviations used: RNase H, ribonuclease H; dsRNA, double-stranded RNA; FAM,
carboxyfluorescein; PDB, Protein Data Bank; WT, wild-type; RT, reverse transcriptase. Biochemical
Journal Immediate Publication. Published on 05 Jan 2010 as manuscript BJ20091553 ...
Diagnosis of nasopharyngeal carcinoma and suppression of nasopharyngeal …
J Juang, S Liu - 2010 - freepatentsonline.com
... In a preferred example, the compound is a double-strand RNA (dsRNA) that inhibits the
expression of any of the genes mentioned above via RNA interference. ... In another example,
the dsRNA is a siRNA that inhibits the expression of the IQGAP1 gene. ...
Characterization of expression, activity and role in antibacterial immunity of …
MK Kajla, O Andreeva, TM Gilbreath III, SM … - … and Physiology Part B: …, 2010 - Elsevier
... Immune challenge to the cell line 2.5. Purification and identification of Lys c-1 2.6. dsRNA
mediated silencing of Lys c-1 and bacterial infections in the KD mosquitoes 2.7. ... 2.6. dsRNA
mediated silencing of Lys c-1 and bacterial infections in the KD mosquitoes. ...
[HTML] Prediction of novel miRNAs and associated target genes in Glycine maxbiomedcentral.com [HTML]
T Joshi, Z Yan, M Libault, DH Jeong, S Park, … - BMC …, 2010 - biomedcentral.com
... The pri-miRNAs are cleaved to miRNA precursors (pre-miRNA), which form a characteristic hairpin
structure, catalyzed by Dicer-like enzyme (DCL1) [7,8]. The pre-miRNA is further cleaved to a
miRNA duplex (miRNA:miRNA*), a short double-stranded RNA (dsRNA) [9]. The ...
Inhibiting Serum Response Factor (SRF) to Improve Glycemic Control
ME Patti, W Jin, AB Goldfine - 2010 - freepatentsonline.com
... RNA Interference. RNA interference (RNAi) is a process whereby double-stranded RNA (dsRNA)
induces the sequence-specific regulation of gene expression in animal and plant cells and in
bacteria (Aravin and Tuschl, FEBS Lett. 26:5830-5840 (2005); Herbert et al., Curr. ...
How the Noninflammasome NLRs Function in the Innate Immune System
JPY Ting, JA Duncan, Y Lei - Science, 2010 - sciencemag.org
... Similarly, viral infection can activate NOD2, leading to its translocation to the mitochondria,
association with mitochondrial antiviral signaling protein (MAVS), and induction of the antiviral
cytokine type I IFN (complex C). NOD2 also interacts with the dsRNA-binding protein OAS2. ...
Minimal-length short hairpin RNAs: The relationship of structure and RNAi activity
Q Ge, H Ilves, A Dallas, P Kumar, J Shorenstein, SA … - RNA, 2010 - rnajournal.cshlp.org
... INTRODUCTION. RNA interference (RNAi) is a naturally occurring process whereby
a double-stranded RNA (dsRNA) of a specific sequence regulates the expression
of genes containing that sequence. RNAi-inducing triggers ...
Poly (I: C) induces BLyS-expression of airway fibroblasts through …
T Yamada, S Lizhong, N Takahashi, S Kubo, N Narita, … - Cytokine, 2010 - Elsevier
... Keywords: BLyS; Fibroblast; Airway; dsRNA; PI3K. Article Outline. ... RNA viruses synthesize
double-stranded RNA (dsRNA) during replication [6], and this is a strong stimulus for
innate anti-viral responses through the secretion of cytokines. ...
S Sun, VB Rao, MG Rossmann - Current Opinion in Structural Biology, 2010 - Elsevier
... On the other hand, some dsDNA viruses (eg tailed bacteriophages and herpesviruses) and
dsRNA viruses (eg φ6 and φ12 bacteriophages) form protein capsid shells first and then package
their genomes into the procapsids. ... Mechanism for dsRNA packaging. ...
DNA Microinjection into the Macronucleus of Parameciumcshlp.org [HTML]
J Beisson, M Betermier, MH Bre, J … - Cold Spring …, 2010 - cshprotocols.cshlp.org
... 2009). Both transgene- and dsRNA-induced silencing correlate with accumulation
of ~23-nt siRNAs (Garnier et al. 2004; Nowacki et al. 2005), the biogenesis of which
involves the constitutively expressed DCR1 gene. Interestingly ...
The rabbit (Oryctolagus cuniculus): A model for mammalian reproduction and early …cshlp.org [HTML]
B Puschel, N Daniel, E Bitzer, M Blum, … - Cold Spring …, 2010 - cshprotocols.cshlp.org
... 2009). Both transgene- and dsRNA-induced silencing correlate with accumulation
of ~23-nt siRNAs (Garnier et al. 2004; Nowacki et al. 2005), the biogenesis of which
involves the constitutively expressed DCR1 gene. Interestingly ...
Structural Insights into the Function of Influenza NS1
ZA Bornholdt, B Carrillo, BVV … - Influenza: Molecular …, 2010 - books.google.com
... It is a multifunctional protein with two domains, a dsRNA binding domain (RBD) and an effector
domain (ED) which interacts with various cellular proteins. ... The known binding sites for dsRNA
and various cellular proteins in these two domains are summarized in Fig. 2.1. ...
[CITATION] CONCISE REVIEW
RNA Therapeutic - HEPATOLOGY, 2010
Adjuvant activity of cytokines.
MG Tovey, C Lallemand - Methods in molecular biology (Clifton, NJ), 2010 - Springer
... TLR3, which recognizes double-stranded viral RNA (dsRNA), the single-stranded RNA
(ssRNA) receptor TLR7, and the CpG DNA receptor TLR9, is localized in the endosomes
of myeloid DCs and requires acidi- fication of vesicles for activation. ...
Extrachromosomal Histone H2B Mediates Innate Antiviral Immune Responses …
K Kobiyama, F Takeshita, N Jounai, A Sakaue- … - Journal of …, 2010 - Am Soc Microbiol
... The immunostimulatory property of dsDNA is quite similar to that of immunostimulatory
RNA (isRNA), such as dsRNA and 5'-triphosphate RNA (2, 6). Indeed, the signaling
pathways engaged by dsDNA in part are shared with those for isRNA. ...
Dendritic cells: Bridging innate and adaptive immunity in atopic dermatitis
N Novak, S Koch, JP Allam, T Bieber - Journal of Allergy and Clinical …, 2010 - Elsevier
... Abbreviations: AD, Atopic dermatitis; AIT, Allergen-specific immunotherapy; DC, Dendritic cell;
dDC, Dermal dendritic cell; dsRNA, Double-stranded RNA; LC, Langerhans cell; mDC, Myeloid
dendritic cell; MoDC, Monocyte-derived dendritic cell; MPL, Monophosphoryl lipid A ...
Recognition of viral nucleic acids in innate immunity
M Yoneyama, T Fujita - Reviews in Medical Virology, 2010 - ingentaconnect.com
... are translo- cated to the nucleus, and form a transcription acti- vator, IFN-stimulated gene factor
3 (ISGF3) with a DNA-binding subunit, IRF-9. ISGF3 activates hun- dreds of IFN-stimulated genes
(ISGs), including the genes for double-stranded RNA (dsRNA)- dependent protein ...
Sequential recruitment of the endoplasmic reticulum and chloroplasts for plant …
T Wei, TS Huang, J McNeil, JF Laliberte, J … - The Journal of …, 2010 - jvi.highwire.org
... for anchoring the virus replication complex (VRC), confine the process of RNA replication to a
specific safeguarded cytoplasmic location, and prevent the activation of certain host defense
mechanisms that can be triggered by double-stranded RNA (dsRNA) intermediates during ...
Structural insights into RNA interference
DG Sashital, JA Doudna - Current Opinion in Structural Biology, 2010 - Elsevier
... of Drosha and Dicer products. In contrast, several silencing factors utilize more
generic dsRNA-binding domains (dsRBDs) to recognize the double-stranded
elements within precursor RNAs. Both Drosha and Dicer associate ...
Small Molecule Modifiers of the microRNA and RNA Interference Pathway
A Deiters - The AAPS Journal, 2010 - Springer
... degradation of a messenger RNA (mRNA) or inhibiting its translation (1–3). RNAi can be triggered
by two classes of RNA molecules: (1) small- interfering RNAs (siRNAs) either endogenously
encoded (3) or derived from longer double-stranded RNA (dsRNA), which are ...
The Role of Toll-Like Receptors in Host Defenses and Their Relevance to …adisonline.com [PDF]
D Terhorst, BN Kalali, M Ollert, J Ring, … - American Journal of …, 2010 - ingentaconnect.com
... Herpes virus DNA ssRNA dsRNA TLR2 ... CpG = cytosine phosphatidyl guanosine; dsRNA =
double-stranded RNA; LP = lipoprotein; LPS = lipopolysaccharides; LTA = lipoteichoic acid;
MD-2 = lymphocyte antigen 96; PGN = peptidoglycan; ssRNA = single-stranded RNA. 2 ...
RNAi: an Antiviral Defence System in Insects
B Goic, MC Saleh - … and Viruses: Current Innovations and Future …, 2010 - books.google.com
... Page 15. Goic and Saleh 4| Cytoplasm Haemolymph Fungi Yeast Gram-positive bacteria
Gram-negative bacteria dsRNA Scavenger receptor family ? ... For the systemic RNAi pathway,
the recognition of viral dsRNA beyond the infected site is important. ...
Compositions Comprising MG29 Nucleic Acids, Polypeptides, and Associated …
J Ma, N Weisleder - 2010 - freepatentsonline.com
... For example, the present invention features a nucleic acid molecule, such as a decoy RNA, dsRNA,
siRNA, shRNA, microRNA, aptamer, and/or antisense nucleic acid molecules, which down
regulates expression of a sequence encoding an MG29 or MG29 receptor proteins. ...
Rotavirus Infection Activates Dendritic Cells from Peyer's Patches in Adult Mice
DV Lopez-Guerrero, S Meza-Perez, O … - The Journal of …, 2010 - jvi.highwire.org
... developing countries (35). RV belongs to the Reoviridae family and contains a genome
composed of 11 segments of double-stranded RNA (dsRNA) that code for six structural
(VP) and six nonstructural (NSP) proteins. RV tissue ...
Virus-encoded Suppressors of RNA Silencing and the Role of Cellular miRNAs in …
J Haasnoot, B Berkhout - RNA Interference and Viruses: Current …, 2010 - books.google.com
... role in antiviral responses in mammals. RNAi is a conserved sequence-specific
gene silencing mechanism in eukaryotes that, similar to the IFN pathway, is triggered
by double- stranded RNA (dsRNA). It plays a pivotal role ...
Medullary Thyroid Carcinoma Cell Lines Contain a Self-Renewing CD133+ …
W Zhu, T Hai, L Ye, GJ Cote - Journal of Clinical Endocrinology & …, 2010 - Endocrine Soc
... Small interference RNA (siRNA). RNA knockdown was achieved through transient
transfection of double-stranded RNA (dsRNA) specifically targeting RET (Sigma).
Control treatments were performed using a randomized dsRNA. ...
RNA Silencing in Plants and the Role of Viral Suppressors
A Giner, JJ López-Moya, L Lakatos - RNA Interference and …, 2010 - books.google.com
... DCL enzymes are multicomponent com- plexes with distinctive dsRNA binding, RNA helicase,
RNase III and PAZ (denominated for being present in Piwi/Argonaute and/Zwille pro- teins)
domains (Bernstein et al., 2001; Hammond et al., 2000). Four DCL homologues have been ...
A histone chaperone, DEK, transcriptionally coactivates a nuclear receptorejcho.info [PDF]
S Sawatsubashi, T Murata, J Lim, R Fujiki, … - Genes & …, 2010 - genesdev.cshlp.org
... plasmid (EcRE-Luc, EcR, and USP with or without dDEK) and then incubated for 16 h in the
absence or presence of Mur (2.5 × 10 −7 M). For knockdown of endogenous dDEK or Tai (EGFP
as a negative control), the cells were preliminarily transfected with dsRNA followed by ...