What you really mean by molecular pathology of cancer

Let’s imagine a patient walks in with a visible tumor in the neck region. An oncologist is supposed to resolve his or her tumor. The oncologist would want to understand the tumor in minute details in order to treat it. At some point of time, S/He will do a biopsy ie, take some part of the tumor and send it to molecular pathologist. A molecular pathologist needs to understand how a doctor would like to resolve cancerous tumor clinically and what all tests S/He needs to device in order to answer oncologist’s questions.

Molecular pathologist will extract DNA from such tumor tissues and get it read using machines called “Sequencers”. Sequencer readout of DNA are hardly encouraging. They look somewhat like this” TTCATTTAAGACCCTAATATGACATCATTAGTGATTAAATGCCACTCCCAAAATTCTGCCTAGAAATGTTTAAGTTCGCT”. But how does analyzing this tumor DNA sequence give you an insight into a cancer?

Good question! Now let’s ask another question, why does tumor forms at the first place. Well! Tumor forms because some cells just completely forget when to stop dividing. Normally cells divide from one to two, from two to four and so on. However, they are subjected to checks and balances and they stop dividing beyond a point. After some time, they also die and their place is quickly taken by a newly born cell. When cells forget when to stop dividing, an endless sequence of division and production of new cells will lead to tumor formation. This leads us to another question, what makes the cell to divide in the first place. If we understand that process, we may be able to pinpoint where the process went haywire in cancer tumor.

Now let’s try to imagine how the cell circuit looks like that is responsible for signaling cells to divide. Have you ever seen a kid breaking a battery powered toy car? Besides mourning the sad demise of the car, you might have noticed that it has a printed circuit board (PCB). PCB looks like an intricate network of signal pathways. At one end of it when you connect battery, the motor at the other end starts moving. Similar to PCB, there are intricate pathways within a cell. In place of battery, certain molecules called growth factors bind at one end of the pathway. This binding signal then relays from one molecule to the other and at the end of which it triggers the complex machinery within the nucleus, that starts the process of cell division.

For eg. The chain of command might go like this- Growth Factor- relay molecule 1- relay molecule 2- relay molecule 3- Cell division. You can clearly see that only when Growth Factor binds to relay molecule 1, that it activates entire process. Thus activated relay molecule 1 in turn activates relay molecule 2 and so forth. So in case Growth Factor is unavailable, cell will not divide. This is one way to control the cell division. ie regulate the amount of growth factor produced.

I will add here that each relay factor is a protein and they are coded by specific sequences of DNA. Let’s say Relay Factor 1 is coded by DNA sequence ATGCTCGATGCGCGTATATATAGCGCGTAGC. While Relay Factor 2 is coded by a different DNA sequence: TTTCGCTCTGAATCGCGCTGACTGT, and so forth. Now let’s imagine that a change occurred in DNA sequence that codes for Relay Factor 2 and it is changed from ATGCTCGATGCGCGTATATATAGCGCGTAGC to ATGGTCGATGCGCGTATATATAGCGCGTAGC. You must be wondering where did it change. Well! A closer look will show you that at 4th letter, the sequence changed from C to G. It seems subtle but many times such subtle changes bring about a big change in the coded protein. Now let’s imagine this subtle change in DNA brought about a big change in the structure of Relay Factor 2. Relay Factor 2 changed in such way that it no longer needs a signal from relay Factor 1 to be carried forward. Instead Relay Factor 2 starts firing on its own and activates Relay Factor 3 and thus eventually signal reaches to the nucleus and orders the cell to divide.

You can quickly notice, now the cell has escaped from control mechanism of Growth Factor. Earlier, the amount of Growth Factor determined the growth of cell. However now that the firing has started from lower down in the command chain, this cell no longer requires Growth Factor to bind to Relay Factor 1. Thus the cell starts dividing uncontrollably and results in a tumor.

A molecular pathologist looks at the clinical history of a patient and predict which parts of its DNA might have undergone changes. He then orders tests to sequence those pieces of DNA. In case he finds a change in a particular piece of tumor DNA, he correlates it to the Relay Factor that might have gone bad and accordingly gives suggestions on treatment, prognosis and classification of cancerous tumor.