Confirming single copy λ prophage integration

Occasionally, λ inserts two copies of itself in tandem into the bacterial chromosome. These double insertions behave differently than a single insertion and depending on your question, it might be important to check that you have a single insertion.

The method to confirm a single integration has been developed by Powell et al. (1994). It uses three primers, one in the host DNA, two in the phage DNA to amplify two sequences. One crosses from host to phage and serves as a positive control. The second spans the joint between the two adjacent prophages (if there is a multicopy prophage). The method is not fool proof. The same sequence occurs in the λ chromosome that is found in virions. To avoid detecting this, one needs to wash the lysogens thoroughly. This means that the presence of a multicopy prophage cannot be detected conclusively. Its absence, however, can be.

Primers:

- attB: gaggtaccagcgcggtttgatc
- attP: tttaatatattgatatttatatcattttacgtttctcgttc
- lambdaint: actcgtcgcgaaccgctttc

All three primers are used in the same PCR. To facilitate the setup of the reaction, individual primers can be premixed at equal ratios and stored. Use a primer concentration of 300 nM (per primer) in the reaction. Annealing temperature is 55 °C, elongation time is 30 sec, the PCR is run for 30 cycles. Uninfected cells will produce no band. Single lysogens will produce one 501 bp band (attB/lambdaint), multicopy prophages will produce two bands: a 501 bp band (attB/lambdaint) and a 379 bp band (attP/lambdaint). Free phage will also produce a 379 bp band (attP/lambdaint). The larger band is the positive control: if there is a lysogen, the band must be there.

The test is not perfect. If there is no short band, you can be pretty sure that you have a single integration. If you see both bands, it may well be that you still have a single integration but were not able to get rid of all phage particles. The problem is, that the reaction for the long band works much better than the one for the short band (probably because the attP primer is so insanely long). I would be better to turn efficiencies around. Like that you will immediately pick up double insertions (or free phage the were not removed), and the positive control (the long band) is more difficult to obtain, which makes the test more conservative.

It is therefore important to wash the cells thoroughly. It is better to wash them in LB instead of water because the pellet is more stable which facilitates the removal of the supernatant. The larger band seems to be generally more intense. The original publication suggests to use colonies from a plate, the following pictures were obtained from overnight cultures.

Figure 1: PCR products from different lysogens. JL259 is a single coply prophage, the others may be multicopy. The positive control is a lysate.

Figure 2: 6 different lysogens were tested. Overnight cultures were washed 3 times in 1 mL cold LB and 2 times in cold water. A dilution series was made of every sample (original, 10^-1, 10^-2, 10^-3, 10^-4) and 1 µL was amplified in a 20 µL reaction volume. All lysogens may contain multiple prophages.

Figure 3: Samples from an experiment, all tested at different dilutions. It appears that some are single copy, while other may be multicopy prophages. The pattern is consistent among dilutions and it appears that higher dilutions give clearer results.