FAQ

What type of input does Rnnotator accept?

Rnnotator accepts FASTQ formatted read files and compressed FASTQ files in bz2 or

gz format as input. For paired-end reads it is expected that read 1 and read 2 are in the

same file and follow one after another in pairs. An example is shown below:

@1044:5:1:1071:20262/1

GGTCAATCTCACGATTTGATGGAANAGCTCGCCACCGGGGCAGAGTTCGAGGATGATATAGTAGTATTGACGTGCC

bbbbbbbbbbb_a`bbbbbbbbb^BZY[U[bbbbbbbbbab_bab_a`b]b^_bb`]aa`]XT`Z_\__]^_K_BB

@1044:5:1:1071:20262/2

GCAACCAGCGTGCCAACATCCTGAAAGAAGTGCAGATCATGCGCAATCTCGATCACCCCAATATCGTCAAGATGAT

bbbabbb_bba^^`bbbbb`bbbc_b`\\b^ab_aaaaa`bcacac_c``aa``ac^`a`aZ^^a^BBBBBBBBBB

Any read length produced by Illumina instruments is acceptable for input to Rnnotator.

However, 150 bp is the longest read length that has been tested with Rnnotator.

Four library types are supported by Rnnotator: nonS, nonP, nonC, strS, strP and strC

meaning non-strand-specific single-end, non-strand-specific paired-end, non strandspecific

composite, strand-specific single-end, strand-specific paired-end, and strand-

specific composite . At least one library must be given as input to Rnnotator. Multiple

FASTQ files can be given for a single library. For example:

$ rnnotator.pl –nonS sampleA.fq sampleB.fq sampleC.fq

Also, the same library type may be used multiple times. For example, if you have

different insert sizes:

$ rnnotator.pl –strP 200 sampleA.fq –strP 500 sampleB.fq

What is the final output of Rnnotator?

final_contigs.fa : the Rnnotator assemblies in fasta format