Lesson 5

Mutant C. elegans Worms

Driving Question:

How do changes in a gene make the mutant worms different from the wild type worms?

By the end of this lesson, we hope that you will be able to:

Demonstrate how the DNA sequence of a gene codes for the amino acid sequence of a protein.
Explain the effect of a single nucleotide change on the function of a protein.
Use a Universal Genetic Code chart to determine the protein sequence of a gene.

Some understanding of the Central Dogma of Biology is helpful for this lesson (how DNA is transcribed into RNA, which is translated into amino acids which become a protein). Learn.Genetics is a great resource for more information.

What is a Mutant?

The word mutant is not new to popular culture.

In 1958, the movie The Fly horrified audiences by showing what happens when a fly's DNA was integrated with that of a human.

In the X-Men series, the mutant characters use use their super-human traits (mostly) for good, while being hated and persecuted by non-mutant humans.

After being contaminated with toxic waste, the Teenage Mutant Ninja Turtles use their powers for good.

In The Hunger Games, Jabberjays, mockingjays and trackerjays were all created by the Capital to make the games more interesting.

On the screen, we mostly see mutations as being either harmful or beneficial. In nature however, many mutations have no consequence at all. Mutations can also lead to traits that allow different organisms to survive and flourish in different environments, as we saw with the C. elegans worms.

Genetic mutation is a major driver of the evolutionary process. Organisms with a mutation that makes them more likely to survive in a particular environment may live to reproduce and pass on their genes, whereas their counterparts without the mutation may die off.

Watch a short video about mutations here. (Learn.Genetics)

How do the mutant worms differ from the wild type worms?

The mutant worms we have been observing are called osmotic mutants because they have a change in a gene that regulates water movement (osmosis). The mutation is a change in the osm-7 gene. The osm-7 gene is involved in, you guessed it, synthesis of the protein we are calling glycerolase. Remember, glycerolase is part of glycerol production which helps a worm to retain water when needed in a salty environment.

DNA to RNA

The DNA strand that codes for the osm-7 gene is about 1700 nucleotides long.
DNA is transcribed to RNA by matching complementary nucleotides, so the mRNA strand is also about 1700 nucleotides long.
The osm-7 gene of the mutant differs by only one nucleotide compared to the wild type.
The mutation is near the middle of the mRNA strand

RNA to Protein

Three mRNA nucleotides code for one amino acid.
The protein made from the wild type mRNA is 562 amino acids long.

Need a refresher on DNA, RNA, proteins, and traits? Click on the Learn.Genetics DNA picture.

Let's look more carefully at the DNA itself. Here is a partial DNA codon strand for the osm-7 gene:

Wild type:
ATGTGTTTTATCCGTAATCGAGCTCTCTGTTTTATC

Mutant:
ATGTGTTTTATCCGTAATTGAGCTCTCTGTTTTATC

Open the Protein Synthesis Simulation, from Concord Consortium.

Step 1: Copy and enter the wild type DNA sequence. Make sure there are no extra spaces.

Step 2: Transcribe the DNA into mRNA.

Step 3: Translate the mRNA to a protein by joining the amino acids together.

REPEAT the steps above with the mutant DNA sequence.

The Affects of a Mutation

How many amino acids long was the protein coded for by the wild type DNA strand?

How many amino acids long was the protein coded for by the mutant DNA strand?

What happened?

This is a Universal Genetic Code chart. It indicates which amino acid is coded for by any codon DNA strand.

To read it, start in the center and work your way out.

Let's decode the DNA codon ATG. First, go to the middle quadrant with an A. From the A quadrant, move outwards to find the slice with a T. From the T slice, move outwards again to find the slice with a G. Moving outwards again indicates that Methionine is coded for by an ATG combination. Methionine is also abbreviated Met, or M.

Feeling confused? The Amoeba Sisters are here to help. Note: The Amoeba Sisters use a chart that decodes mRNA (in which U is substituted for T). Our chart decodes DNA. But if you know how one works, you know how both work!

Here are the partial DNA strands for each type of worm. Let's see how the mutation changed the end protein, glycerolase.

This time the DNA sequences are put in 3-codon groups to make them easier to read.

Wild type:
ATG TGT TTT ATC CGT AAT CGA GCT CTC TGT TTT ATC

Mutant:
ATG TGT TTT ATC CGT AAT TGA GCT CTC TGT TTT ATC

Use the Universal DNA Codon Table and a piece of paper to write down the amino acid sequence in the protein for the wild type and the mutant worms.

Lesson 5 Comprehension Questions

A. What is the amino acid sequence coded for by the wild type gene?

B. What is the amino acid sequence coded for by the mutant gene?

C. How are these sequences different?

D. Explain whether you think the mutant protein would still function properly.

E. Use the Universal Genetic Code chart to explain how a single nucleotide change in the DNA can have a dramatic effect on the resulting protein.

F. Use the Universal Genetic Code chart to explain how a single nucleotide change can have NO effect on the resulting protein.

Next Step: Go to the Assessment

Page updated

Report abuse