Reaching the Needy People

Healthy Moringa Leaf and its Production Technologies

முருங்கை இலை உற்பத்தி : Visit the Youtube page : https://www.youtube.com/watch?v=AySqPfWzF80&t=73s (it is in Tamil Language)

If you need it in English, write to me

DNA Barcoding of Moringa Ecotypes available at HC&RI, Periyakulam

The following information would be useful for those who are involved in Export / Import of moringa leaves and its powders

Earlier studies in other major crop plants clearly demonstrated that as that of other crops, DNA barcoding can also be effectively used to differentiate the moringa germplasm accessions with more accuracy. Such differentiation is essential for tapping the potential of moringa germplasm in future breeding programme. Hence an ninvestigation was designed with the objective of evaluating the morphological, biochemical and molecular characterization of moringa germplasm. Sixty moringa accessions collected from different regions, of Tamil Nadu and Andhra Pradesh were planted and maintained in Moringa Genetic Resources Garden, located at HC&RI, PKM and were used for this investigation. Sixty moringa genotypes were evaluated by using IPGRI minimal descriptors and observations were recorded for 14 morphological characters. NCBI GenBank IDs KT737744 to KT737801 comprises the sequences of ITS region available in the investigated moringa germplasm.

DNA Barcoding

This section describes collection of leaf samples for DNA isolation and purification from other nucleic acid and protein impurities, PCR amplification of matK and ITS genic regions, analysis of PCR products, sequencing of PCR products and use of such DNA sequences in identifying and characterizing Moringa accessions. Barcoding, generally, relies on short, highly variably regions of the genome. With thousands of copies per cell, mitochondrial and chloroplast sequences are readily amplified by polymerase chain reaction (PCR), even from very small or degraded specimens. A chloroplast gene matK and a nuclear internal transcribed spacer (ITS), a variable region that surrounds the 5.8 S ribosomal RNA gene, are used for barcoding in this study. Initially, a sample of Moringa leaf tissue was collected from the investigated accessions and DNA was extracted from the tissue, and the barcode portions of the matK and ITS were amplified by PCR. The amplified sequences (amplicons) were submitted for sequencing in both directions. The sequencing results were then used to search the DNA database. A close match has quickly identified that the DNA sequence was already represented in the database and it was associated with Moringa. Then, the sequences of each Moringa germplasm entry was analysed by following essential steps as described below that helped to precisely distinguish each Moringa accessions.

DNA isolation

The standard plant DNA extraction kit (Chromos Biotech Ltd., Bengaluru) was used to isolate and purify the DNA from ~1 g of each 60 Moringa leaf samples. Use of DNA isolation kit is inexpensive and has the advantage of working reproducible with homogenized Moringa leaf samples which is rich in mucilage and other macro molecule impurities. The integrity and sufficient quantity of the isolated DNA was checked using 0.8 per cent agarose gel electrophoresis. Prior to PCR, sample DNA was dissolved in TE buffer (Tris/EDTA: Tris provides a pH 8.0 environment to keep DNA and RNA nucleases less active. EDTA further inactivates nucleases by binding cations required by nucleases) in such a way that each Moringa sample contain 50 ng/μl and stored at -20°C.

Polymerase chain reaction (PCR)

To amplify a DNA barcode region, the most appropriate set of primers for each target genes viz., matK and ITS were obtained from the literature and they are described below.

Name of the Gene Name of the primer Primer sequence (5’ to 3’ direction) Reference

matK Forward CGATCTATTCATTCAATATTTC Lahaye et al. 2008

Reverse TCTAGCACACGAAAGTCGAAGT

ITS Forward GGAAGGAGAAGTCGTAACAAGG Selvaraj et al. 2012

Reverse TCCTCCGCTTATTGATATGC

The above said oligomer primers were synthesized at Chromos Biotech Ltd., Bengaluru and used for polymerase chain reaction (PCR) along with DNA samples, Taq DNA polymerase with the following PCR profile.

Initial step : 94°C 1 minute 35 cycles of the following profile :

Denaturing step : 94°C 15 seconds

Annealing step : 54°C 15 seconds

Extending step : 72°C 30 seconds

One final step to preserve the sample: 4°C ad infinitum

After completion of the PCR, the PCR products generated by the two genes from all the Moringa samples were analyzed using 2 per cent agarose gel electrophoresis. Those samples that have shown poor amplification were again PCR amplified until they produced sufficient amount of target PCR products.

Sequencing

The target PCR products generated by matK and ITS were sent to Chromos Biotech Ltd., Bengaluru for sequencing from both ends. Since the PCR product size range from 860 -880 bp, it was decided to sequence from both ends since the sequencing result can produce less than 400 bp in a single reaction. The bidirectional sequences were used to arrive the consensus sequence of the full length PCR product.

Bioinformatics analysis

Initially, the sequence results of all the samples for both the genes were critically analyzed for the primer sequences. If there was any ambiguity or lesser sequences than the expected, the sequencing process was repeated. Then those positively confirmed sequences were made simple nucleotide BLAST analysis by following the steps described in the Basic Local Alignment Search Tool (BLAST) available at the internet site of the National Center for Biotechnology Information (NCBI). Such protocol was used to confirm that the sample sequences are > 90 per cent related to the Moringa sequences that were deposited in NCBI database.

The Blue Line of DNA Subway, available at http://dnasubway.iplantcollaborative.org/ was employed to analyze the above said Moringa germplasm DNA sequences. DNA Subway is an intuitive interface for analyzing DNA barcodes. It analyzes the relationships between DNA sequences by comparing them to a reference sequence or sequence of our interest. Generating a phylogenetic tree from DNA sequences derived from related accessions had also helped to draw inferences about how these accessions were related.

Analyzing the sequence relationship and construction of phylogenetic tree using DNA subway protocol was performed as described in the manual and it involved the following brief steps:

1. A new project was created under “Determine Sequence Relationship” Blue line.

2. The sequences of the Moringa accessions for each gene viz., mat K and ITS were provided separately (as two different runs) in the “Select Sequence Source” tab in FASTA format along with one out-group sequence which was obtained from NCBI for the respective gene.

3. “View and Build Sequences” were used to verify the uploaded sequences and correct if there is any error while uploading the sequences.

4. Consequently, “MUSCLE”, the multiple alignment algorithm was selected. This software align all sequences that were included in the previous step. An alignment that is suitable for creating a phylogenetic tree will have an overall high Sequence Conservation Score (represented by the height of the gray bars along the Sequence Conservation row at the top).

5. The resultant window was scrolled down to see similarities between sequences. Nucleotides were color coded and each row of nucleotides was the sequence of a single Moringa accession. Columns were matches (or mismatches) at a single nucleotide position across all sequences. Dashes (-) were gaps in sequence, where nucleotides in one sequence were not represented in other sequences.

6. The MUSCLE alignment was used to produce phylogenetic tree using “PHYLIP ML” tab that was available under MUSCLE tab. It opened a window that generated a phylogenetic tree using the maximum likelihood method. A phylogenetic tree is a graphical representation of relationships between taxonomic groups. In this experiment, a gene tree (matK or ITS) was determined by analyzing the similarities and differences in DNA sequences of Moringa germplasm. The branch tips are the DNA sequences of individual Moringa accessions. Any two branches are connected to each other by a node, which represents the common ancestor of the two sequences. The length of each branch is a measure of the evolutionary distance from the ancestral sequence at the node. Moringa accessions with short branches from a node were closely related, while those with longer branches were more distantly related. A group formed by a common ancestor and its descendants was called a clade. Related clades, in turn, were connected by nodes to make larger, less closely-related clades. Clicking on a node, highlight sequences in that clade.

7. Similarly, another type of phylogenetic tree was constructed using the neighbor joining method by clicking on “PHYLIP NJ” tab under MUSCLE tab.

Results were could not be obtained from seven samples (MO 16, MO 22, MO 28, MO 34, MO 43, MO 44 and MO 49) for mat k gene; however the ITS gene was amplified in all the 60 moringa samples (GenBank ID: KT737744 to KT737801). Bidirectional sequences were used to arrive at the consensus sequence of the full length PCR product for each sample. Besides, as an out-group, JX092021.1| Moringa oleifera maturase K (mat K) gene, partial cds of chloroplast and AY845130.1| Moringa oleifera 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 (ITS), complete sequence; partial sequence were obtained from National Center for Biotechnology Information (NCBI) for further downstream analysis. Initially, the sequence results of all the samples for both the genes were critically analyzed for the primer sequences. If there was any ambiguity or lesser sequences than the expected, the sequencing protocol was repeated. Then those positively confirmed sequences were made simple nucleotide BLAST analysis to confirm that the sequences are > 90 per cent related to the Moringa sequences deposited in NCBI database.

The Blue Line of DNA Subway, available at http://dnasubway.iplantcollaborative.org/ was employed to analyze Moringa germplasm DNA sequences. A new project was created under “Determine Sequence Relationship” Blue line. The sequences of the Moringa accessions for each gene viz., mat K and ITS were provided separately (as two different runs) in the “Select Sequence Source” tab in FASTA format along with one out-group sequence in each analysis. “View and Build Sequences” were used to verify the uploaded sequences.

Consequently the multiple alignment algorithm, “MUSCLE”, was selected and all the sequences were aligned based on overall high Sequence Conservation Score (represented by the height of the gray bars along the Sequence Conservation row at the top in the Plate 3 and Plate 4 for each gene). The resultant window was scrolled down to see similarities between sequences. Nucleotides were color coded and each row of nucleotides was the sequence of a single Moringa accession. Columns were matches (or mismatches) at a single nucleotide position across all sequences. Dashes (-) were gaps in sequence, where nucleotides in one sequence were not represented in other sequences.

The first row represent the conserved sequences of matK and ITS genes, respectively that were obtained from the sequencing results. The second row represents the overall variation present in the investigated moringa accessions and the third row represents the consensus sequence / barcode. Higher the conservation made the particular accession to be placed as first in the order. For example, for matK gene sequence, MO 15 has highest sequence conservation and hence placed in the top. It was followed by MO 25 and MO 15 since it had next best conserved sequence for the gene matK. With respect to ITS gene sequence, the maximum conservation was noticed in MO 44 followed by MO 53. However, when compared with matK, ITS has more number of single nucleotide polymorphism.

The MUSCLE alignment file was used to produce phylogenetic tree using “PHYLIP ML” tab that was available under MUSCLE tab. It opened a window that generated a phylogenetic tree using the maximum likelihood method. Gene tree (individually for matK and ITS) was determined by analyzing the similarities and differences in DNA sequences of Moringa germplasm. The branch tips were the DNA sequences of individual Moringa accessions. Two branches were connected to each other by a node, which represented the common ancestor of the two sequences. The length of each branch was a measure of the evolutionary distance from the ancestral sequence at the node. Moringa accessions with short branches from a node were closely related, while those with longer branches were more distantly related, with respect to the given gene. A group formed by a common ancestor and its descendants was called a clade. Related clades, in turn, were connected by nodes to make larger, less closely-related clades.

Phylogenetic tree constructed mat K gene sequences classified all the investigated accessions into two groups. As expected, group I was constituted by out-group alone and rest of the investigated moringa accessions were grouped as group II. Group II was further divided by minor and major clade. Two accessions viz, MO 48 and MO 53 were grouped as clade I and the remaining accessions comprised as major clade II. The bootstrap values were marked at the point of node divergence. The maximum divergence was noticed in node II between MO 48 and MO 53. Significantly higher divergence was also found in MO 59 with rest of the accessions. Maximum conservation on mat K was noticed between MO 54 and MO 46.

Similarly, phylogenetic tree constructed by ITS gene sequences classified all the investigated accessions into two groups. As expected, group I was constituted by out-group alone and rest of the investigated moringa accessions were grouped as group II. In this ITS phylogenetic tree topology, MO 53, MO 54 and MO 52 were grouped as clade I and the remaining accessions comprised as major clade II. The boot strap value was marked at the point of node divergence. The maximum divergence was noticed in node I among MO 53, MO 54 and MO 52. The highest conservation on the sequence of ITS was seen between MO 36 and MO 47, MO 25 and MO 12 and MO 42 and MO 24.

Incubating Farmers/Students/Private Companies for their Start-Ups in Horticulture Business

Please contact me for your registration or incubation space or marketing of horticultural products at +919842509611 or mail me at nmboopathi@tnau.ac.in