Functional analysis of viral immediate early proteins

Description

Viral immediate early proteins often function as transcriptional activators that transactivate the expression of subsequent genes. Using an Sf9 cell culture system, we have developed a two-plasmid cotransfection system for identifying the transactivation activity and transactivation domain of a viral immediate early protein. The first plasmid in this system produces the IE protein fused with the GAL4 DNA-binding domain (GAL4_DBD). The second plasmid is a luciferase reporter plasmid containing the luciferase gene under the control of a minimal promoter containing five consecutive binding sites for the GAL4 DNA-binding domain.

Brief protocol

Characterization of viral immediate early proteins transactivation activity: (i) Luciferase effectors. The plasmid pIZΔIE/V5-His was used as a starting point in dual-luciferase reporter assays as described above. Part (~2 kbp) of the WSSV IE1 promoter fragment upstream of the ATG was amplified from the WSSV genomic DNA (using the primers CGGAATTCGATGATGGTGATGTTTCTAGG and CCGCTCGAGCTTGAGTGGAGAGAGAGAGC [underlined sequences represent the restriction enzyme recognition sites]) and cloned into pIZΔIE/V5-His. The resulting plasmid was designated pWSSV-V5-His and was used to express the full-length ie coding region, the GAL4 DBD (1), and various fusion proteins consisting of the GAL4 DBD plus downstream in-frame insertions of different regions of the ie coding sequence To construct the GAL4 DBD gene plasmid (pWSSV-GAL4-V5-His), the gene sequence encoding GAL4 DBD amino acids (aa) 1 to 147 was amplified by PCR from yeast genomic DNA (using the primers 5’-GCTCTAGAATGAAGCTACTGTCTTCTATC-3’ and 5’-TCCCCGCGGCGATACAGTCAACTGTCTTTG-3’) and then cloned into the XbaI/SacII-digested pWSSV-V5-His plasmid. (ii) Luciferase reporters. The reporter plasmid p35_BAS-Luc, which contained the firefly luciferase reporter gene, was constructed by PCR cloning of the Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) p35 basal promoter into the pGL3-Basic vector (using the primers CCGCTCGAGTGGCGACGGATTTTTATATACA and CCCAAGCTTTTTGCAATGGTAAAGCTCAAA).The other reporter plasmid, G5p35_BAS-Luc, contained five copies of the GAL4 DNA binding site upstream of the AcMNPV p35 basal promoter, and it was constructed by amplifying five copies of the GAL4 DNA binding site from pG5SEAP (Clontech), using primers CGGGGTACCGATCGGAGTACTGTCCTCCG and CCGCTCGAGCAAGCTAATTCCCGGGGATC, and then cloning them into p35_BAS-Luc vector KpnI and XhoI sites. (iii) Transient transfections and dual-luciferase reporter assay. The Sf-9 cell culture and transfection methods are described above. For transactivation assay, cells were cotransfected with 300 ng of the reporter plasmid containing the firefly luciferase gene, 500 ng of one of the different effector plasmids or the empty vector, and 100 ng of the Renilla luciferase gene plasmid, phRL/AcMNPVie1. The phRL/AcMNPVie1 plasmid contains the AcMNPV ie1 promoter to drive the expression of the Renilla luciferase gene and was used to monitor and normalize transfection efficiency. Cells were collected at 48 h posttransfection, and the cell lysates were prepared according to the Promega instruction manual for the dual-luciferase assay system. Luciferase activities were determined for triplicate transfections in two independent experiments, and the means and standard deviations were calculated.

Some of our publications that have used this platform

1. Liu, W.J., Chang, Y.S., Wang, H.C., Leu, J.H., Kou, G.H., and Lo, C.F. (2008). Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate early protein IE1. J. Virol. 82, 11362-11373.