Embedded Files
In case the GOVT of India gives approval for validated lab developed assays to be deployed, the in silico section guides the user to design and check the efficacy of primers in Serial Cloner program version 2.6. Serial Cloner version 2.6 is vetted by us. With good user interface, you can perform RT-PCR within the software and check its efficacy before using the primers in the wet lab.
In case the GOVT of India gives approval for validated lab developed assays to be deployed, the in silico section guides the user to design and check the efficacy of primers in Serial Cloner program version 2.6. Serial Cloner version 2.6 is vetted by us. With good user interface, you can perform RT-PCR within the software and check its efficacy before using the primers in the wet lab.
Make primers and do in-silico RT-PCR of SARS-CoV-2 virus.
Make primers and do in-silico RT-PCR of SARS-CoV-2 virus.
SARS-CoV-2 virus genome sequence available at: https://www.ncbi.nlm.nih.gov/genbank/sars-cov-2-seqs/
SARS-CoV-2 virus genome sequence available at: https://www.ncbi.nlm.nih.gov/genbank/sars-cov-2-seqs/
SARS-CoV-2 primers, Institut Pasteur, Paris
SARS-CoV-2 primers, Institut Pasteur, Paris
COVID19 primers Instut Pateur.pdfPrimer sequences:
Primer sequences:
SARS-CoV-2 primers-
nCoV_IP2-12669Fw: ATGAGCTTAGTCCTGTTG
nCoV_IP2-12759Rv: ATGAGCTTAGTCCTGTTG
nCoV_IP2-12696bProbe(+): AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1
Beta Sequence of all coronavirus (Not specific for SARS-CoV-2) primers-
E_Sarbeco_F1: ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_R2: ATATTGCAGCAGTACGCACACA
E_Sarbeco_P1: ACACTAGCCATCCTTACTGCGCTTCG [5']Fam [3']BHQ-1
Internal control (Extraction control) primers-
GAPDHPrimerF1: GCATTCGCCCTCTTAATG , Tm- 58 C, Length- 18 bp.
GAPDHPrimerR1: GCCCAATACGACCAAATC , Tm- 58 C, Length- 18 bp.
GAPDHprobe: CTCACATATTCTGGAGGAGCCT [5']Cy5 [3']BHQ-1, Tm- 63, Length- 22 bp.
Designed using IDT Primerquest tool: https://eu.idtdna.com/Primerquest/Home/Index . Primer pairs yet to be wet lab tested.
SARS-CoV-2 positive control (Synthetic control RNA for 2019-nCoV E gene assay is available via EVAg) available at: https://www.european-virus-archive.com/
SARS-CoV-2 positive control (Synthetic control RNA for 2019-nCoV E gene assay is available via EVAg) available at: https://www.european-virus-archive.com/
Ref: https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf, Berlin Jan17, 2020.
Page updated
Google Sites
Report abuse