Genetic Code

By the end of this units students should be able to

Explain and relate the following terms: cells, chromosome, DNA and genes
Recall that genetic information is passed down from one generation of organisms to the next.
Understand that each species has its own unique set of genes that make that species function in its own unique way.
Understand that the information stored in genes that the cells read is written using four bases adenine (A), thymine (T), cytosine (C) and guanine (G).
Describe and apply the complementary base-pairing rule.
State that the genetic code is stored in DNA within cells.
Students should be able to describe the structure of DNA as a double helix that is made up of bases in a specific sequence.
Label a diagram of DNA using terms nucleotide, sugar, phosphate, bases (A, C, T and G) and base pairs.
describe the structure of DNA as a twisted sugar and phosphate back bone with bases in between.
name and describe the pairing of the four bases in DNA.
construct a DNA model.
describe DNA’s role in passing on characteristics from one generation to the next
Distinguish between DNA, gene, and allele.
Describe what a genome is.
Describe briefly the 6 key stages in mitosis (in-depth details are not required)
Define meiosis.
Explain how cell division by meiosis leads to genetic variation.

Vocabulary list (definitions at the bottom of the page): adenine, alleles, base pair, characteristic, chromosome, cytosine, dominant, gene, guanine, hydrogen bond, inheritance, meiosis, mitosis, mutation, nucleotide, phosphate, population, recessive, replication, ribose, species, thymine, trait, variation

Differences in living things

You may have gone to the zoo and looked at a lion and noticed it was like a cat. You may have thought that a lion is more like a cat than a Great Dane is like a Chihuahua (although a biologist wouldn't agree with you).
Cats and dogs are more similar to each other than either is to a fish, but both are more similar to a fish than they are to a tree.
We all realize that there are levels of similarity and differences between living things, even without any formal understanding of biology.

As far as scientists know, all living things today are descended from a single common ancestor.

Therefore, all living things are related to each other. The degree of relatedness can be shown on a 'tree of life' diagram such as the one shown here.

The place where two branches join represents the common ancestor from which two different types of organism have descended.

The further down the tree you need to go to find where two branches meet up, the further back in time it is before you reach that common ancestor.

Genetics vs Environment

We all know that a cat will always give birth to a kitten and never a puppy. You might not have thought much about this, but it is obvious that there must be some way that the features of living things are passed on from one generation to the next. We now know that this happens through genes. Genes explain the difference between cats and dogs, but what about the difference between a Great Dane and a Chihuahua?

You have probably heard some discussion of 'nature versus nurture'. This refers to whether a particular characteristic is something you are born with or something to do with the environment.

The fact that environment influences the development of an organism is very obvious. This is particularly true of plants, which have less different types of tissue than animals and more flexibility with where organs (such as flowers or leaves) can develop on their "body".

For example, look a tree that grows by the coast where there is a fairly constant wind in one direction, as shown in the picture on the left. When new branches budded off in the windward direction, they would be more prone to being windburned and not developing properly.

This leads to more growth on the branches on the leeward side of the tree, giving the shape shown in the picture. However, the fundamentals of the tree must remain unchanged e.g. if it is a flowering plant, it must continue to develop flowers rather than cones.

The strong influence of genetics is most obvious humans when you look at "identical" twins. These are twins who have developed as two separate embryos from one single fertilised egg; the biological term for this is monozygotic twins (from "mono" = one "zygote" = fertilised egg). They therefore started from the same genes.

Any differences between such twins must be caused by environment.

There have been cases of monozygotic twins being adopted into different families, and raised separately in different environments.
Scientists have studied these people closely, and most studies seem to agree that when it comes to things like personality, intelligence, general health and so on, the influence of genes over environment is well over 50% and could be as high as 80%.

However, environment does still make a difference. If one twin were to work out and the other didn't, there would be differences in their body mass and muscle development. This does count as variation since it is the body's response to environmental factors.

DNA

The letters DNA stand for deoxyribonucleic acid. It is the chemical that carries the genetic code.

The way the code is carried is in the pattern of four chemicals which make up the rungs of a 'twisted ladder' in a giant molecule. The diagram on the left has 'untwisted' part of the ladder to make it easier to see:

In this illustration:

the round, blue shapes in the sides represent "phosphate" groups, that have a phosphorus and 4 oxygen atoms in it
the brown pentagons are a sugar, deoxyribose
the polygons with the letters are the nucleic acids.

the dotted lines between the nucleic acids represent a type of weak attractive force between them, which holds them together a bit like velcro. The two halves can be "ripped apart" and made to join up again.

The sides of the chain are made of alternating phosphate groups and the sugar . The phosphates join the sugars together.

The 'rungs' of the 'ladder' are called base pairs. Each base pair is made of two chemicals joined together.

Each of the four colours on the 'rungs' of the diagram below represents one of the four chemicals that make up the base pairs. We represent these chemicals with the letters A, T, G and C.

The four 'letters' of the DNA chain are what contain the genetic information. There are rules for the way they join up in a base pair:

A always joins with T
C always joins with G

The weak force between them is known as hydrogen bonding, and you will learn more about it if you advance in chemistry.

The four letters stand for the name of four chemicals:

A stands for adenine
T stands for thymine
C stands for cytosine
G stands for guanine

These chemicals belong to a group of compounds known as amino acids. In the context of DNA they are called bases and two of them joined up together are called a base pair.

The combination of a base, a sugar (ribose) and a phosphate is called a nucleotide (picture below the spiral DNA diagram below). The bonds within the nucleotide are much stronger than the bonds between the two halves of the DNA chain.

The rungs on one side will consist of a series of letters e.g.

…CGGATTCGAGCATTATGCCATTAGCCG…

Those letters are grouped into threes which are called “codons”; these are the “words” of the genetic code:

…CGG ATT CGA GCA TTA TGC CAT TAG CCG…

These in turn are grouped into “sentences” called genes. A gene is an instruction for a cell to do a certain thing (usually make a chemical). A gene can be tens to hundreds of letters long.

There can be different versions of the gene for the same thing e.g. different versions of the gene for eye colour. These different versions of a gene are called alleles.

When organisms reproduce there can sometimes be a change in the genetic code, called a mutation. If the altered gene still works, but works differently, it is now an allele of the original gene. This way you can get gradual genetic changes in a population. For example, the red hair and green eyes common in Celtic populations are a mutation from their brown eyed and brown haired ancestors.

A very important property of DNA is its ability to make copies of itself. When this happens, the DNA chain 'unzips'. Each half is then joined by nucleotides which are floating around in the cell nucleus. They join on to the right place in the half-chain because of the rules about A-T and C-G. As a result, each half of the "zip" is able to make a copy of the other half:

DNA replication is needed for cells to produce identical copies of themselves. This is the process by which you have developed into billions of cells from a single fertilised egg. It is also how your body makes new cells for growth and repair.

The process of making new, identical cells is called mitosis.

Chromosomes

Genes and strands of DNA are not just left to float around inside the cell. Instead, they are bundled up into structures in the cell nucleus called chromosomes. Particular chromosomes often have a recognisable shape because of the way the DNA bundles up, and they need to become "unbundled" when the cell divides to make new cells.

A diagram of the chromosomes for a particular organism is called a karyogram. On the right is a karyogram from a human male.

The chromosomes come in pairs. One half of each pair comes from the sex cell of each parent. In the karyogram on the left, one chromosome in each pair came from the egg cell from the man's mother; the other came from the sperm cell from the man's father. The man has 23 pairs of two chromosomes, making a total of 46 chromosomes.

When your body makes sperm cells, there is a special process that halves the number of chromosomes in the sperm cells compared to the body cells. It also ensures that each sperm cell contains a mixture of genes from both chromosomes in each pair of the body cell. This means that each sperm cell contains only 23 chromosomes, but that each one has a mixture of genes from both of your parents. A similar process occurs in the production of an egg cell. This process is called meiosis.

Genetic Diversity

As explained above, the letters of the genetic code can be altered. This commonly happens in cell division. A change in the genetic code is called a mutation. For example, the sequence AGC ATT ATG could change to AGC ATG ATT by the swapping around of two codons. Even a single letter can change.

This will sometimes (not always) change the way a gene works. It may stop the gene working altogether. For example, the garden plant agapanthus has two different flower colours: purple or white.

The purple colour is made by a protein contained on a single gene. If that gene is faulty it it can't make the protein to make the purple colour. Therefore, the "purple-making" gene and the "non-working purple making gene" are two different alleles of the same gene. We could call the non-purple one white (although it really is just a purple one that doesn't work; white is the background colour with no purple).

The plant has two copies of every gene (one from each parent). Therefore, the plant could have three possible combinations of this allele: purple-purple, purple-white or white-white.

The plant only needs ONE copy of the purple allele to make the purple dye. Therefore, both the purple-purple and the purple-white plants will be equally purple (white is not a colour, it is just the flower colour in absence of purple). Having two purple alleles doesn't cause the plant to make more purple: it can either make the dye or it can't. It can't if it doesn't have the instructions. The gene is only the instructions.

We have some genetics terms we use about this situation.
Firstly, we can describe the situation where the two alleles in the plant are the same or are different. We would describe both the purple-purple combination and the white-white combination as homozygous.
We would call the purple-white combination heterozygous.

Second, since the plant only needs one copy of the purple allele to make purple, the plant will always be purple as long as it has at least one copy. We say that the purple allele is dominant, because it will 'show up' as long as there is at least one copy. The only way an agapanthus plant can have a white flower is if it DOESN'T have a copy of the purple allele. Such a plant must be homozygous and be white-white. We therefore say that the white allele is recessive.

Recessive alleles can by hidden, dominant ones can't. This is why inbreeding can be bad. There are many genetic diseases carried by recessive alleles, but they do not affect an organism unless it has two copies. If the recessive allele is rare in the population, the chances of inheriting it from both parents is low. However, if there is a lot of inbreeding the chances of inheriting such recessives from both parents is greatly increased.

Features which show only two versions of a variation (such as the purple or white flowers of agapanthus) are controlled by a single gene. However, many forms of variation (such as height in humans) are the result of many genes, each of which has two alleles. As a result, a person can be any variation of height depending on the combination of genes they have (called their genome).

Mutations can only be passed on from one generation to the next when they happen in sex cells (sperm or egg). These mutations happen during meiosis.

Mutations can happen in body cells, during mitosis. Most are harmless but sometimes the mutated cells can multiply without restraint. This is what causes cancer. The cells of a cancer tumour have mutated.

The variety of life

Mutation causes changes in genes and leads to different alleles. From these different alleles, different characteristics arise. Within a species, this is known as genetic variation and is the reason you are not identical to any of your classmates.

As long as two populations are genetically isolated from each other (they do not interbreed), each will acquire a unique set of mutations and genes. Eventually, the genetic difference become so great that they interfere with cell division or prevent fertilisation. At this point, the two populations become separate species - no longer capable of successful interbreeding.

The fox and the dog above are an example. They have very similar features, as a result of evolving in response to similar environmental factors. Over millions of years, the cumulative genetic changes means that the chromosomes are now different and can no longer combine from a sperm and egg. A dog might mate with a vixen (this occasionally happens) but she will not become pregnant. Any eggs fertilised by the dog sperm will die: their chromosomes are too mixed up to permit mitosis.

It is this process, repeated thousands of times over hundreds of millions of years, that has led to the diversity of life today. Each species has a unique set of characteristic genes which make it what it is.

Words and definitions

Adenine: DNA base represented by the letter A

Alleles: Different forms of the same gene

Base pair: The pair of letters on the DNA chain

Characteristic: A special feature of a living thing

Chromosome: The structure in the cell that contains the ‘bundled up’ DNA

Cytosine: DNA base represented by the letter C

Dominant: A genetic trait that cannot be hidden and must show up if it is present

Gene: A section of the DNA chain with the instruction for making one protein

Guanine: DNA base represented by the letter G

Hydrogen bond: The weak chemical bonds joining the bases in a base pair

Inheritance: The property of genetic information being passed on from one generation to the next

Meiosis: The process of cell division that produces sex cells such as sperm

Mitosis: The process of cell division that produces body cells

Mutation: A change in the DNA code

Nucleotide: The combination of one base, one sugar and one phosphate

Phosphate: The chemical group that joins the sugars on the side of the DNA chain

Population: A group of organisms within a species that breed together

Recessive: A genetic trait that can be present in the genes but which can be ‘hidden’ in some individuals

Replication: The process where a DNA chain duplicates itself

Ribose: The sugar on the side of the DNA chain

Species: A group of organisms capable of interbreeding

Thymine: DNA base represented by the letter T

Trait: A feature of a living thing that can be passed on via inheritance

Variation: The normal differences within a species

Report abuse