7.1 U1 Nucleosomes help to supercoil the DNA.
7.1 U1 Nucleosomes help to supercoil the DNA.
Embedded Files
Be able to:
Draw and label the structure of a nucleosome, including the H1 protein, the octamer core proteins, linker DNA and two wraps of DNA.
Explain the levels of supercoiling (DNA→ nucleosome → beads on a string → 30nm fiber → unreplicated interphase chromosome → replicated metaphase chromosome).
DNA is arranged in chromosomes in eukaryotes. Each chromosome contains one very long DNA molecule.
Packaging of DNA is necessary. For example, in each human cell there is approximately 2m of DNA distributed between 46 chromosomes, yet the average diameter of each cell is only 10–30µm.
A packaged unit of the chromatin fibre is called a nucleosome, which looks like a bead on a thread.
Each nucleosome is composed of:
two loops of DNA, approximately 150bp long, wrapped around 8 central histone proteins; central histone proteins have structures that influence how tightly the DNA is packaged
another type of histone, called H1, that binds the DNA to the central ‘bead’.
There is a short segment of naked DNA between each nucleosome. This is known as linker DNA.
The nucleosomes arrange into coils, and in preparation for nuclear division, the coiled structure coils up again, to form a supercoiled chromosome. Nucleosomes are important for the safe storage of DNA. They also play an important role in the regulation of transcription.
7.1 U 2 DNA structure suggested a mechanism for DNA replication.
7.1 U 2 DNA structure suggested a mechanism for DNA replication.
Be able to:
Outline the features of DNA structure that suggested a mechanism for DNA replication.
DNA is double stranded and shaped like a ladder, with the sides of the ladder made out of repeating phosphate and deoxyribose sugar molecules covalently bonded together. Each deoxyribose molecule has a phosphate covalently attached to a 3’ carbon and a 5’ carbon. The phosphate attached to the 5’ of one deoxyribose molecule is covalently attached to the 3’ of the next deoxyribose molecule forming a long single strand of DNA known as the DNA backbone. DNA strands run antiparallel to each other with one strand running in a 5’ to 3’ direction and the other strand running 3’ to 5’ when looking at the strands in the same direction.
The rungs of the ladder contain two nitrogenous bases (one from each strand) that are bonded together by hydrogen bonds.
Since these two strands are anti-parallel replication occurs in different directions on the DNA strand
Purines are two ring nitrogenous bases and pyrimidines are single ring nitrogenous bases.
The nitrogenous bases match up according the Chargaff’s Rules in which adenine (purine) always bonds to thymine (pyrimidine), and guanine (purine) always bonds with cytosine (pyrimidine).
7.1 U 3 DNA polymerases can only add nucleotides to the 3’ end of a primer.
7.1 U 3 DNA polymerases can only add nucleotides to the 3’ end of a primer.
Be able to:
Compare replication on the the leading strand and the lagging strand of DNA.
Explain why replication is different on the leading and lagging strands of DNA.
Outline the formation of Okazaki fragments on the lagging strand.
The DNA polymerases are enzymes that create DNA molecules by assembling nucleotides, the building blocks of DNA. These enzymes are essential to DNA replication and usually work in pairs to create two identical DNA strands from one original DNA molecule. During this process, DNA polymerase “reads” the existing DNA strands to create two new strands that match the existing ones.
Every time a cell divides, DNA polymerase is required to help duplicate the cell’s DNA, so that a copy of the original DNA molecule can be passed to each of the daughter cells. In this way, genetic information is transmitted from generation to generation.
Before replication can take place, an enzyme called helicase unwinds the DNA molecule from its tightly woven form. This opens up or “unzips” the double stranded DNA to give two single strands of DNA that can be used as templates for replication.
DNA polymerase adds new free nucleotides to the 3’ end of the newly-forming strand, elongating it in a 5’ to 3’ direction. However, DNA polymerase cannot begin the formation of this new chain on its own and can only add nucleotides to a pre-existing 3'-OH group. A primer is therefore needed, at which nucleotides can be added. Primers are usually composed of RNA and DNA bases and the first two bases are always RNA. These primers are made by another enzyme called primase.
7.1 U 4 DNA replication is carried out by a complex system of enzymes.
7.1 U 4 DNA replication is carried out by a complex system of enzymes.
DNA replication creates two identical strands with each strand consisting of one new and one old strand (semi-conservative). DNA replication occurs at many different places on the DNA strand called the origins of replication (represented by bubbles along the strand).
Enzymes used in DNA replication
Enzymes used in DNA replication
DNA gyrase:
an enzyme that relieves strain while double-strand DNA is being unwound by helicase
causes negative supercoiling of the DNA
Helicase:
controls unwinding of coiled DNA
separates complementary strands of DNA, producing a replication fork
single strand binding proteins:
binds to single-stranded regions of DNA to prevent the two strands from rejoining by complementary base pairing
allow other enzymes to function effectively on it
RNA Primase:
DNA polymerase III is only able to add DNA nucleotides to a free 3’ end on an existing DNA strand
therefore, RNA primase uses the DNA template to synthesize a short 10 RNA nucleotide sequence known as an RNA primer
DNA polymerase III:
DNA polymerase III uses a single parent strand of DNA as a template
adding free dexoyribonucleoside triphosphates from solution to the parent/template strand
according to the complementary base pairing rules (A=T, G=C)
DNA polymerase III can only add deoxyribonucleoside triphosphates to a free 3’ end of an existing nucleotide strand
thus, on only one of the two strands of DNA can DNA polymerase III synthesize continuously in the direction toward the replication fork: this is known as the leading strand
DNA polymerase I:
DNA polymerase I is a proofreading enzyme
removes the RNA nucleotides of the RNA primer
replacing them with DNA nucleotides
DNA ligase:
forms covalent bonds linking together Okazaki fragments
completing DNA synthesis along the lagging strand
7.1 U 5 Some regions of DNA do not code for proteins but have other important functions
7.1 U 5 Some regions of DNA do not code for proteins but have other important functions
Be able to:
Explain the need for RNA primers in DNA replication.
Explain what is meant by DNA replication occurring in a 5' to 3' direction.
Genes contained within DNA called coding sequences, code for polypeptides created during transcription and translation. The majority of DNA are non-coding sequences that perform other functions such as regulators of gene expression, introns, telomeres and genes for tRNAs.
Unique or single-copy genes include exons and introns
exons code for mature mRNA which codes for polypeptides
introns are transcribed into RNA, but then removed by enzymes which splice together exons into mature mRNA, which codes for polypeptides
Genes for other RNA types do not code for proteins
code for tRNA
code for rRNA
Some sections of DNA act as regulators of gene expression
regulators are involved in switching genes on or off
Telomeres at the ends of chromosomes do not code for proteins
Highly repetitive sequences serve no known function
also known as satellite DNA, constitute 5-45% of the genome
sequences are 5-300 base pairs per repeat, and my be repeated up to 10,000 times per genome
the function of repetitive DNA is not known
since repetitive sequences vary from person to person, they are useful in DNA profiling, which allows for DNA fingerprinting to identify samples from individuals
The regions of DNA that do not code for proteins should be limited to regulators of gene expression, introns, telomeres and genes for tRNAs.
DNA sequencing of the human genome reveals that 98.5% does not code for proteins, rRNA or tRNA
about a quarter of the human genome codes for introns and gene-related regulatory sequences
7.1 A 1 Rosalind Franklin’s and Maurice Wilkins’ investigation of DNA structure by X-ray diffraction.
7.1 A 1 Rosalind Franklin’s and Maurice Wilkins’ investigation of DNA structure by X-ray diffraction.
Be able to:
Outline the process of X-ray diffraction.
Outline the deductions about DNA structure made from the X-ray diffraction pattern.
Rosalind Franklin and Maurice Wilkins used a method of X-ray diffraction to investigate the structure of DNA. they were able to determine some helical dimensions using x-ray diffraction. X-ray diffraction patterns are regular, therefore, helix dimensions must be consistent.
Franklin’s data was shared by Wilkins with James Watson (without Franklin’s permission) who, with the help of Francise Crick, used the information to create a molecular model of the basic structure of DNA. In 1962, Watson, Crick and Wilkins (but not Franklin) were awarded the Nobel prize for their contributions to DNA structure identification
7.1 A 2 Use of nucleotides containing deoxyribonucleic acid to stop DNA replication in preparation of samples for base sequencing.
7.1 A 2 Use of nucleotides containing deoxyribonucleic acid to stop DNA replication in preparation of samples for base sequencing.
Be able to:
Define VNTR.
Explain why VNTR are used in DNA profiling.
Dideoxyribonucleotides inhibit DNA polymerase during replication, thereby stopping replication from continuing. Dideoxyribonucleotides with fluorescent markers, are used and incorporated into sequences of DNA, to stop replication at the point at which they are added. This creates different sized fragments with fluorescent markers that can be separated by gel electrophoresis and analyzed by comparing the color of the fluorescence with the fragment length.
7.1 A 3 Tandem repeats are used in DNA profiling.
7.1 A 3 Tandem repeats are used in DNA profiling.
Short tandem repeats (STRs), also known as variable tandem repeats (VNTRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence. These short repeats show variations between individuals in terms of the number of times the sequences is repeated.
For example, CATACATACATACATACATACATA is a STR where the nucleotide sequence CATA is repeated six times for one individual. However, in another individual, this tandem repeat could occur only 4 times CATACATACATACATA. These variable tandem repeats are the basis for DNA profiling used in crime scene investigations and genealogical tests (paternity tests). The diagram to the right shows how the different number of these alleles for the VNTRs are used to create a DNA fingerprint of an individual.
7.1 S 1 Analysis of results of the Hershey and Chase experiment providing evidence that DNA is the genetic material.
7.1 S 1 Analysis of results of the Hershey and Chase experiment providing evidence that DNA is the genetic material.
Be able to:
State the experimental question being tested in the Hershey and Chase experiment.
Explain the procedure of the Hershey and Chase experiment.
Explain how the results of the Hershey and Chase experiment supported the notion of nucleic acids as the genetic material.
Hershey Chase animation
Hershey Chase animation
In the mid-twentieth century, scientists were still unsure as to whether DNA or protein was the genetic material of the cell. It was known that some viruses consisted solely of DNA and a protein coat and could transfer their genetic material into hosts. In 1952, Alfred Hershey and Martha Chase conducted a series of experiments to prove that DNA was the genetic material
7.1 S 2 Utilization of molecular visualization software to analyse the association between protein and DNA within a nucleosome.
7.1 S 2 Utilization of molecular visualization software to analyse the association between protein and DNA within a nucleosome.
Be able to:
Identify nucleosome structures using molecular visualization software.
Outline the mechanism of histone-DNA association.
COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT
Nature of Science
Nature of Science
Making careful observations—Rosalind Franklin’s X-ray diffraction provided crucial evidence that DNA is a double helix. (1.8)
Describe Rosalind Franklin’s role in the elucidation of the structure of DNA.
TOK
TOK
Highly repetitive sequences were once classified as “junk DNA” showing a degree of confidence that it had no role. To what extent do the labels and categories used in the pursuit of knowledge affect the knowledge we obtain?
COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT
Report abuse