figur
figur
Fast Identification of a Genome's Unique Regions
We've developed a tool which can quickly locate segments of dna which are unique to a particular genus, species, or strain. These regions are then used to detect the presence of the organism in a sample. It has been used in-house to to design microarrays but is probably useful to a wider audience.
>example_seq_1
AAACAATGCGGCTTCTTTAACATGATGTG
Above is a pattern of 29 nucleotides. Despite its short size, it is a unique genetic fingerprint for particular class of viruses [1] [2]. To see for yourself, copy and paste it into NCBI's blast server. Be sure to set 'Choose Database' to 'Others'. Notice that it only occurs at 100% similarity for its full length in Western and Eastern Equine forms.
In most cases, we can easily provide a list of the largest regions which have similar properties, for any genomes that may interest you. Typically these regions will be hundreds to thousands of nucleotides long, allowing plenty of options for primer design.
Just by visiting this page you've already helped me to measure interest in this technology. If you would like to know more or have suggestions for how this might be applied, please contact:
Michael Cariaso
cariaso@yahoo.com