cf7

Research Paper

Comparison of Three Assays to Detect Low Pathogenic Avian Influenza Viruses

in Wild Aquatic Birds 

Bouchra Missoum, Debbie Payne, Boakai K. Robertson, Karyn Scissum-Gunn, and Hongzhuan Wu*

Department of Biological Sciences, Alabama State University, 915 S Jackson St. Montgomery, Alabama 36101, USA, * Corresponding author, Hongzhuan Wu, Email: hwu@alasu.edu

Received May 1. 2017, revised July 25, 2017, accepted July 27, 2017

Publication Date (Web): July 27, 2017

© Frontiers in Science, Technology, Engineering and Mathematics

Abstract

Low pathogenic avian influenza virus (AIV) commonly occurs in wild birds. In most cases, it causes minor sickness or no noticeable signs of disease in birds. It is not known to affect humans at all. The only concern is the possibility of it being transmitted to poultry. In poultry, it has the ability to mutate into a highly pathogenic avian influenza strain (HPAI). HPAI virus may mutate or reassort into a strain capable of efficient human-to-human transmission and cause a pandemic that could kill a large fraction of the human population. Careful selection and observance of standard field and laboratory protocols are critical for successful detection and characterization. In this study, AIV isolates from Dr. Giambrone’s lab (Auburn University) were inoculated to 9-day-old specific pathogen free embryos. Viral RNA from the above allantoic fluid (AF) was extracted by Trizol. Three assays, including reverse-transcription PCR (RT-PCR), real-time reverse transcription-PCR (RRT-PCR), and hemagglutinin assay and inhibition (HA-HI) were further used to test the bird flu virus. The sensitivity and specificity of the above three methods were compared. A detection threshold of 2 X105 RNA copies of virus could be detected by RRT-PCR in the lab, proving it to be the most sensitive method among the three assays. A laboratory protocol for the detection of AIV field aquatic bird fecal samples was therefore proposed.

Keywords

Avian influenza virus, Hemagglutin, Detection, RT-PCR, RRT-PCR

Introduction

Avian influenza virus is a single-stranded, segmented RNA virus part of the family Orthomyxoviridae and genus influenza virus A. The virus has an envelope with a host-derived lipid bilayer and covered with about 500 projecting glycoprotein spikes with hemagglutinating and neuraminidase activities (Handberg et al 2001)). Avian influenza viruses are classified serologically into subtypes: hemagglutinin and neuraminidase. As of today, 17 hemagglutinin and 10 neuraminidase subtypes are known. The infectivity of avian influenza virus is first detected by the host enzymatic cleavage of the hemagglutinin protein (CDC 2010)). Influenza A viruses has eight separate gene segments. The eight segments of single stranded RNA of negative polarity encode for at least 10 viral proteins. The quick and efficient identification of AIV is critical due to the fact that the virus can cause major illness and in very many cases leads to death (Ligon 2005).  In order to correctly and quickly identify Influenza A viruses, one must first understand the viruses’ genome. Influenza A has a genome that is divided into single-stranded negative sense RNA (CDC 2010). The single stranded RNA combines together with virally encoded nucleoprotein to form ribonucleoprotein. It is important to understand the segmented nature of Influenza A viruses because there is a huge amount of antigenic variation in the envelope protein of Influenza A. Conversely, the virus’s nucleoprotein is relatively conserved. The nucleoprotein is encoded by viral genome segment number 5. Due to the constant variation occurring in the envelope protein, encoding of the envelope protein is difficult relative to encoding the nucleoprotein (Handberg et al 2001). Influenza A viruses have the ability to recombine from two different species and create a new influenza A virus. The virus produced could have hemagglutinin and neuraminidase that have not been seen before. This can then spread from human to human causing a pandemic (CDC 2010).

The result of an avian influenza infection depends on both the virus strain and host. In order to determine the virulence of a certain strain of AIV, one must inoculate the virus in chickens and then determine the site in the amino acid sequence at which the hemagglutinin cleaves (Handberg et al 2001). The pathogenicity of AIV in chickens is influenced by the presence or absence of many basic amino acids at the hemagglutinin cleavage site.  Clinical studies must focus on avirulent viruses that contain multiple basic residues at the hemagglutinin cleavage site because they have the potential to become very pathogenic by a single mutation (Claas et al 1998). Influenza A viruses has the ability of crossing over from one species to another species. This was first observed in 1998 when H3N2 viruses from humans were introduced into the pig population and caused illness and death. Another example is the H3N8 viruses from horses crossing over to dogs and causing illness (Ligon 2005). Avian influenza A viruses may be transmitted directly from birds to humans or through an intermediate host (Handberg et al 2001).

When a new strain of influenza A virus arises in the human population, its effects are detrimental causing serious illness. Over time, the virus quickly spreads from person to person leading to what becomes a global pandemic (Ligon 2005). The fear of a global pandemic is primarily why AIV is significant.  The most recent human influenza pandemic occurred in Hong Kong in 1968 (Claas et al 1998). That strain of influenza was identified as H3N2. Influenza A H3N2 carried a new haemagglutinin, which is an antigenic glycoprotein found on the surface of all influenza viruses. The pandemic in 1957 also carried a new haemagglutinin and neuraminidase. Neuraminidases are used as antigenic determinants on the surface of the virus. Scientists perform several studies and concluded avian viruses were responsible for these newly emerging glycoproteins. These glycoproteins entered the human population after reassortment with human influenza virus strains (Morens et al 2012).

In order to identify the different subtypes, haemagglutination and neuraminidase inhibition tests against a battery of polyclonal or monospecific antisera to each of the 17 haemagglutinin (H1–17) and 10 neuraminidase (N1–10) subtypes of influenza A virus are performed. Another option is to use RNA detection technologies with subtype specific primers and probes, RRT-PCR, or sequencing and phylogenetic analysis to identify the genome of specific H and N subtypes (WHO 2012).  Reassortment and mixed infection allow for multiple HA-NA subtype combinations and genotypes. Viruses constantly switch hosts to infect multiple species because influenza A host barriers are fairly weak. It is understood that all avian and mammalian influenza A viruses emerged from a global avian virus gene pool; this is possible through frequent reassortment. However, the influenza A H1N1 virus of the 1918 may have entered the human population without a reassortment event. H1N1 caused the most shocking pandemic and killed more than 20 million people worldwide. Later, H1N1 reappeared in 2009 causing a pandemic that is now known to have involved a reassorted virus produced from two kinds of porcine influenza (Morens et al 2012). To prevent severe damage caused by AIV, using rapid and sensitive assay to identify the correct serotype is the priority. In this study we compared three assays in detecting AIV in the lab and also tested clinical samples collected from wild birds in Southern US.

Materials and Methods

Sample Collection and Virus control

Control AIV virus H10N7 strain was provided by Dr. Joseph J.Giambrone’s laboratory at Auburn University. Samples were taken directly from fecal samples of nesting waterfowl from parks in Alabama and Georgia. Swabs were placed in a tube containing 2 mL of virus-transport medium (PBS plus 5% fetal bovine serum, supplemented with 10,000IU/mL of penicillin G and 10 g/mL of streptomycin Sulfate), kept cold in the field with wet ice or frozen in dry ice and transferred to a _70°C freezer within 5h. Frozen tubes containing cloacal swabs in transport medium were thawed and centrifuged at 2,000 _ g for 10 minutes. The cotton-tipped swab was discarded and the supernatant was aliquoted into 3 vials for use in egg embryo inoculation (aliquot 1), and RRT-PCR (aliquot 2).

RNA Isolation by Using TRIzol

Viral RNA of AIV was isolated with TRIzol (Invitrogen, Carlsbad, CA).  The reagent separated allantoic fluid into aqueous and organic phases with the addition of chloroform and centrifugation. After phase separation, nucleotides remain in the aqueous phase while DNA and proteins are sequestered into the interphase and organic phase. RNA was precipitated from the aqueous phase by addition of isopropanol, washed with ethanol and solubilized with DEPC water.

Hemagglutination (HA) and HI Tests

HA titers in AF were determined with chicken erythrocytes by standard procedures (Alexander 1997). The HA+ were identified by adding 1 drop of AF from each egg into a labeled 96- well plate. Fifty microliters of 0.5% chicken red blood cells (CRBC) were added to each well and after 45 min of incubation at room temperature, results were recorded as positive (HA+) when CRBC were hemagglutinated, or formed in a latticework giving a solid pink appearance to the entire well. Wells that had pelleted CRBC, which ran in a tear-drop shape upon tilting the plate 45°, were negative. Allantoic fluid from HA+ eggs was harvested, and the HA titers were determined. The HA+ AF was tested for AIV by HI (Thayer et al 1998) using AIV antisera (Longman Ltd).

Reverse Transcription PCR (RT-PCR)

RT-PCR was carried out following the manufacturer’s protocol (Invitrogen, Carlsbad,CA) using the following program: 500C for 30 min, followed by 34 cycles of 940C for 15 s, 550C for 30 s, 720C for 1 min each cycle, and one cycle of 10 min at 720C. The RT- PCR product was examined by 1% agarose gel electrophoresis.

Real-Time Reverse Transcription PCR (RRT-PCR)

Total RNA was extracted from fecal samples using TRIzol (Invitrogen, Carlsbad, CA) by using 0.5 ml of TRIzol per 0.5 ml of virus (Chomczynski 1993). Five micrograms of total RNA were treated with 1.0 unit of DNAse I and 1.0µl of 10 x reaction buffer (Sigma, St. Louis, MO), incubated for 15 min at room temperature, 1.0 µl of stop solution was added to inactivated DNase I, and the mixture was heated at 700C for 10 min. RNA was reverse transcribed using Superscript first-strand synthesis system (Invitrogen, Carlsbad, CA) according to manufacturer’s recommendations. Published oligonucleotide primers sequences were used: sense primer Bm-HA-(TATTCGTCTCAGGGAGCAAAAGCAGGGG) and antisense primer Bm-NS-890R (ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT) (Homffman et al 2001). These primers were synthesized by Invitrogen. Amplification and detection were carried out using equivalent amounts of total RNA from samples using the QuantiTect SYBR Green PCR kit (Qiagen, Valencia, CA).

Results

After collecting AIV isolates from Dr. Joseph J. Giambrone’s laboratory, samples were inoculated to a 9-day-old specific pathogen free embryo, and viral RNA was extracted from the allantoic fluid. The three assays were performed. Figure 2A, 2B, and 2C show the results of the three different immunoassays: HA-HI, RT-PCR, and RRT-PCR. Table 1 displays the detection of AIV in 20 field samples using the different assays.

Table 1. Evaluation of the Three Assays Using Clinical Samples*

*To evaluate the clinical sensitivity of the three assays, a total of 20 samples were tested. The results indicated that the RRT-PCR were the best assay for avian fecal samples because it resulted in the largest number of positive samples. The HA-HI test detected 5 positive samples, and 15 other samples to be positive. This displays the sensitivity of the HA test to be low because it detects any virus that clots the CRBCs. Next, RT-PCR detected 5 positive samples out of the 20 field samples tested. RRT-PCR detected 6 samples to be positive out of the 20 field samples.

Figure 1. Experimental Design. This figure depicts the layout of the experiment.

Figure 2A. HA Test Results. The above figure shows two-fold serial dilution of AIV and its reaction with chicken red blood cells (Rows C and E). Wells H7 and H8 are negative controls. Out of 20 feces samples, 6 of them were inoculated into embryonated eggs. 5 of the samples were HA+, and RT-PCR could not detect AIV when the HA titer was lower than 26. In contrast, RRT-PCR detected AIV from AF having an HA titer as low as 29 dilution, indicating it is the most sensitive technique.

Figure 2B. Amplification of HA gene from AIV Alabama strain (H10N7) with RT-PCR. Column M indicates the DNA molecular weight marker XV II (Roche applied Science, Penzberg, Germany) added to 1kb of virus. Columns 1-2 are samples 1 and 2. Columns 3-6 are samples 3-6.HA gene1.7Kb are highlighted in the circle.

Figure 2C. Sensitivity of RRT-PCR for purified AIV sample. The sensitivity of the RRT-PCR was determined by testing a serial dilution of cDNA of the AIV. Briefly, AIV viral RNA and cDNA concentration was detected by Nano-drop spectrometer. The cDNA was made ten-fold serial dilution from 1:10 to 1:108 as template; real-time PCR was performed according to the description in the materials and methods section. A detection of 2 X105 RNA copies of virus could be detected by RRT-PCR in the lab. Ct is the cycle threshold, which means the number of cycles required for fluorescent signal to cross the threshold. Ct levels are inversely proportional to the amount of target nucleic acid in the sample (Livak et al 2001).

First, the HA-HI test detected the highest number of false positive samples. The HA-HI test detected 15 negative samples to be positive. Next, RT-PCR detected 5 positive samples out of the 20 field samples tested. RRT-PCR detected 6 samples to be positive out of the 20 field samples.

 In conclusion, RRT-PCR proved to be the most sensitive technique in detecting AIV when we field sample tested, it is identical with our lab virus dilution detection results. RT-PCR is more sensitive than HA-HI but less sensitive than RRT-PCR. We can conclude HA-HI to be the least sensitive technique in detecting AIV. Not only is RRT-PCR the most sensitive technique, but this method possesses the most advantages. Advantages include high specificity, cost-efficiency, time efficiency, rapid time-to-result, and scalability.

Discussion

With the present threat of the next influenza pandemic on the rise, it is critical to find the most sensitive and specific technique for detecting low pathogenic AIV. Most methods of identification and confirmation are time consuming and lack specificity. Although low pathogenic AIV has no effect in humans, it has the ability to mutate into a highly pathogenic strain in poultry. Since influenza A has the ability to cross over from one species to another, the spread of AIV would affect humans as well as birds. When this reassortment event occurs, a new influenza A virus is created. Consequently, this new influenza virus is the basis for a dangerous pandemic.

Our study focused on three methods of detection: reverse-transcription PCR, real-time reverse transcription PCR, and hemagglutinin assay and Inhibition. We discovered the advantages and disadvantages of each method. The most sensitive and specific technique was identified as RRT-PCR and can be used for further research in identifying influenza subtypes. Figure 1 shows our flowchart of lab protocols used to detect avian influenza virus in wild aquatic birds.

In efforts to find a more rapid method of virus isolation, scientists found real-time reverse transcriptase PCR to be a rapid assay. Its results could be available in less than 1 day. RRT-PCR is also more cost efficient. RRT-PCR allows for the detection and measurement of products during each PCR cycle. It involves an oligonucleotide probe that hybridizes with the target sequence. Cleavage of the probe during PCR because of the 5' nuclease activity of Taq polymerase be used to detect amplification of the target-specific product. Also, RRT-PCR offers the advantages of speed and no post-PCR sample handling, thus reducing the chance for cross-contamination versus standard RT-PCR (Senne et al 2002).

In comparison to virus isolation, RRT-PCR reduces the handling of infectious material. The risk of cross-contamination of new samples with previously amplified products because the sample tube is never opened after PCR. Since the RRT-PCR product is detected with a sequence-specific probe, there is confirmation that the correct target was amplified. This reduces the chance of false positives in the results. RRT-PCR assay is very time efficient. In the study done by Senne (Senne et al 2002), 28 clinical samples were processed and tested in 3 hours. When compared to VI and HA, RRT-PCR performed the best overall. 94% of the VI-positive markets were also positive by RRT-PCR and 97% of the markets that were H7 positive by HA were H7 positive by RRT-PCR (Senne et al 2002).

Real time polymerase chain reaction has greatly improved detection methods of AIV. Since not all of these methods include an Internal Positive Control to monitor for false negative results, Trani et. al developed a one-step reverse transcription real time PCR with a Minor Groove Binder (MGB) probe for the detection of different subtypes of AIVs, an IPC is included in this technique (Trani et al 2006).

RRT-PCR was developed using an improved TaqMan technology with a MGB probe to detect AI from reference viruses. The primers and probe were designed based on the matrix gene sequences from most animal and human A influenza virus subtypes. The specificity of RRT-PCR was assessed by detecting influenza A virus isolates belonging to subtypes from H1–H13 isolated in avian, human, swine and equine hosts. Serial dilutions of in vitro transcribed matrix gene RNA to determine the analytical sensitivity of the RRT-PCR assay (Hoffman et al 2001).

The results showed that RRT-PCR has the ability to detect all tested influenza A viruses. The detection limit of the assay was shown to be between 5 and 50 RNA copies per reaction and the standard curve demonstrated a linear range from 5 to 5 _ 108 copies. The same results were easily repeatedly reproduced. The analytical sensitivity of the RRT-PCR proved to be 10–100 times higher than conventional RT-PCR. As a result of the high specificity and sensitivity of the AIV RRT-PCR with the use of IPC to monitor for false negative results, RRT-PCR should be used for more accurate detection of AIV (Trani et al 2006).Our results support our hypothesis that RRT-PCR is the most specific and sensitive technique for detecting AIV. Future research can be done with RRT-PCR to further reveal epidemiology of AIV in southern states.

Acknowledgements

We would like to thank Dr. Joseph J Giambrone at Auburn University for allowing us to use their facilities at their laboratory.

References

Alexander DJ (1997) Newcastle disease and other Paramyxoviridae infections. Dis. Poultry. 10, 542–570.                      

Centers for Disease control and Prevention (2010) Key Facts about Avian Influenza (Bird Flu) and Highly Pathogenic Avian Influenza A (H5N1) Virus.

Claas E, Osterhaus A, Beek R, Jong J, Rimmalzwaan G, Senne D, Krauss S, Shortridge K, Webster R (1998) Human Influenza A H5N1 virus related to a higly pathogenic avian influenza virus. Lancet. 351, 147-189.

Chomczynski P (1993)  A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques. 15,  532-537.

Dormitorio TV, Giambrone JJ, Guo K, Hepp GR (2009) Evaluation of field and laboratory protocols used to detect avian influenza viruses in wild  aquatic birds. Poultry Sci., 88,1825-1831.

Handberg K, Jorgensen P, Munch M, Nielsen LP (2001) Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA. Arch. Virol., 146. 87-97.

Hoffman E, Stech J, Guan Y, Webster RG, Perez DR (2001) Universal primer set for the full-length amplification of all influenza A viruses. Arch. Virol. 146(12):2275-89.

Ligon L (2005) Avian Influenza Virus H5N1: A review of Its History and Information Regarding Its potential to Cause Next Pandemic. Pediatric Infec. Dis., 16, 326-335.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25, 402-408.

Morens D, Taubenberger J (2012) Influenza Viruses: Breaking All the Rules. mBio 4(4), e00365-13. (Doi:10.1128/mBio.00365-13).

Noroozian H, Vasfi M (2006) Detection of avian influenza virus of H9 subtype in the feces of experimentally infected chickens by RT-PCR. Arch Razi Institute. 62, 181-189.

Senne D, Spackman E, Suarez D(2002) Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenza Virus and the Avian H5 and H7 Hemagglutinin Subtypes. J Clin Microbiol. 40, 3256-3260.

Thayer SG, Beard CW(1998) Serologic procedures. A Laboratory Manual for the Isolation and Identification of Avian Pathogens. pp. 255–266.

Trani L, Bedini B, Donatelli I, Campiteli L, Chiappini B, Marco M, Delogu M, Buonavoglia C, Vaccari G (2006) A sensitive one-step real-time PCR for detection of avian influenza virus using MGB probe and an internal positive control. BMC Infect. Dis., 6:87.

World Health Organization (2012) Avian influenza., pp.1-19.

Citation:

Bouchra Missoum, Debbie Payne, Boakai K. Robertson, Karyn Scissum-Gunn, and Hongzhuan Wu (2017) Comparison of three assays to detect low pathogenic avian influenza viruses in wild aquatic birds, Frontiers in Science, Technology, Engineering and Mathematics, Volume 1, Issue 1, 49-55