11-18 Archive

11-18

CEO's GRILLED over Whistleblower Evidence of De-platforming Collusion Between Big Tech https://www.youtube.com/watch?v=ugdJdcE6QlI

o property, no privacy: World Economic Forum essay imagines a 2030 communist shift https://www.youtube.com/watch?v=t4y97RxIOX4

Global governance is incompatible with democracy | Spencer Fernando with Ezra Levant https://www.youtube.com/watch?v=6RyzFIi21nk

Dr.SHIVA LIVE: MIT PhD, Inventor of Email, Exposes the Real Frauds Who Destroy Our Democracy. https://www.youtube.com/watch?v=umNbSvqozwQ

Dr.SHIVA LIVE: What Is To Be Done? Time to Weaponize Yourself With the Ultimate Education. https://www.youtube.com/watch?v=TAxr3EgsJik&t=1415s

MASS MEDIA AND BIG TECH: THE WORLD ENABLERS OF FRAUD CORRUPTION WAR AND GENOCIDE https://www.bitchute.com/video/LDII9k78NzTt/

Dr. E. Michael Jones returns to Our Interesting Times to discuss the election debacle and the apparent color revolution being carried out in the United States. Dr. Jones is the editor of Culture Wars magazine and the author of many books including the recently published Logos Rising: A History of Ultimate Reality. https://www.podomatic.com/podcasts/tkelly6785757/episodes/2020-11-18T05_40_52-08_00

https://fee.org/articles/gavin-newsom-apologizes-for-breaking-his-own-covid-rules-other-californians-went-to-jail/

https://fee.org/articles/half-of-politics-is-the-refusal-to-be-imposed-upon/

Ep. 1778 Media Targets COVID Dissidents 18th November 2020Tom Woods3 COMMENTS To put it mildly, the mainstream media has not exactly distinguished itself during the COVID crisis. Wild, gruesome predictions that never panned out have rarely been noted or corrected. In the UK, the average person thinks the number of deaths is literally 100 times greater than it actually is. Collateral damage from lockdowns is hardly mentioned. That’s why we’ve had to depend on more independent voices for the fuller truth. Within the past several days to such voices have come under attack, And in today’s episode we speak to Jennifer Cabrera, one of those two. https://hwcdn.libsyn.com/p/3/4/7/3475cecaa8763c63/woods_2020_11_17.mp3?c_id=88771667&cs_id=88771667&expiration=1605745432&hwt=a4eeef248803336d6ebd0ea988acedb2 https://www.youtube.com/watch?v=ooY-STPqsBY&feature=youtu.be

ilad Atzmon discusses the new Hate Crime Bill which could see people prosecuted for things they have said at home. He'll also be chatting about identity politics & how it has shaped our response to the arbitrary and nonsensical lockdown measures. Don't miss. The Richie Allen Show Tuesday November 17th 2020 https://www.podomatic.com/podcasts/richieallen/episodes/2020-11-17T11_35_09-08_00

http://tapnewswire.com/2020/11/the-shocking-reason-why-pfizers-coronavirus-vaccine-requires-storage-at-70c-because-it-contains-experimental-nanotech-components-that-have-never-been-used-in-vaccines-before/

Robert Steele 100 Resignations from Congress Sidney Powell After BigTech, John Brennan to Jail? https://www.youtube.com/watch?v=EFWRZiU_DGE&feature=emb_logo

https://www.armstrongeconomics.com/international-news/china/why-china-will-become-1-world-economy/

I discuss how the entire election system is UPSIDE DOWN and how the media never discusses the REAL problems. The people can't even agree on HOW to have the election. What is the point of moving on from that? The media does nothing but color inside the lines over and over. The govt should have to PROVE the election is valid, not the other way around. That makes no sense. https://the-quash.captivate.fm/episode/the-elections-are-upside-down

The elusiveness of sanity in an insane world By Jonathan Cook http://www.informationclearinghouse.info/55889.htm

Read the original article at TomWoods.com. http://tomwoods.com/ep-1778-media-targets-covid-dissidents/

https://www.lewrockwell.com/2020/11/gary-d-barnett/is-this-virus-the-weapon-being-used-to-usher-in-a-communistic-takeover-of-the-united-states/

https://principia-scientific.com/study-covid-19-vaccine-can-destroy-your-immune-system/

EXCESS DEATHS DUE TO LOCKDOWN.. LISTEN: https://archive.org/details/lockdown_vodoo_the_tom_-woods_show_11-12_22min_mp3

https://survivalblog.science.blog/2020/11/16/the-hunger-game-has-begun-the-elite-have-begun-their-full-scale-execution-and-decimation-of-the-middle-class/


11-17

Butterfly of the Week, 16 November: The '90%' Mythical Pfizer/Moderna Unicorns https://www.youtube.com/watch?v=GuhAKXQTc04 Discussing the two recently announced vaccines from Moderna and Pfizer. If a vaccine fails to test the most important part of a vaccine - the ability to contain the spread of disease - can it really be considered a vaccine?

We’re Under Martial Law NOW, It’s About to Get Much Worse https://banned.video/watch?id=5fb2d2d3e7557c36552139c8 Texas just killed jury trials until at least Feb 2021. Fauci says “do what you’re told”, forget individual liberty. We’re under Martial Law already. It’s about to get much worse as troops are being called out. The David Knight Show

https://www.activistpost.com/2020/11/the-dystopian-fourth-industrial-revolution-will-be-very-different-from-the-first-one.html

https://www.activistpost.com/2020/11/thousands-of-electric-vehicles-recalled-by-gm-due-to-battery-fires.html

https://www.naturalnews.com/2020-11-17-prepping-on-the-road-a-beginners-guide-to-living-in-a-travel-trailer-full-time.html

https://www.naturalnews.com/2020-11-16-10-survival-uses-for-rubbing-alcohol.html

RCEP hops on the New Silk Roads http://www.informationclearinghouse.info/55884.htm

https://principia-scientific.com/study-covid-19-vaccine-can-destroy-your-immune-system/

https://www.investmentwatchblog.com/denmark-after-9-days-of-banging-pots-pans-outside-parliament-the-epidemic-law-is-scrapped-protesting-works-do-it/

the coolest saxophone player ever https://www.youtube.com/watch?v=JD8ZO5P9yzQ

https://www.rt.com/op-ed/506872-asean-trade-deal-us-lose/


Everybody Knows the Fight was Fixed http://www.informationclearinghouse.info/55886.htm


https://www.globalresearch.ca/the-global-capitalist-cage-and-the-corona-crisis-solutions-by-those-who-have-created-the-problems/5727349

https://www.bleadon.org.uk/media/other/24400/VernonColemanHowDidWeGetHereTranscript06JUN20.pdf

Proof That Face Masks Do More Harm Than Good http://alternativeprinciplesforhealth.info/wp-content/uploads/2020/11/proof-that-masks-do-more-harm-than-good.pdf

https://archive.org/details/the-100-most-beautiful-melodies


11-16

http://tapnewswire.com/2020/11/elite-transnational-fascism-covid-the-gameplan/

https://humansarefree.com/2020/09/proof-covid-19-planned-new-world-order.html

https://ia601400.us.archive.org/20/items/ultimate-proof-covid-19-was-planned-to-usher-in-the-new-world-order-pdf-format/Ultimate%20Proof_%20Covid-19%20Was%20Planned%20To%20Usher%20In%20The%20New%20World%20Order%20PDF%20FORMAT.pdf

The Cult(ure) of Scientific Misdirection This is an excellent presentation on epidemiology by Thomas Woods https://www.youtube.com/watch?v=aBFZOGgAZzY

DR. VERNON COLEMAN ON THE RICHIE ALLEN SHOW (BANNED BY YOUTUBE BURIED BY MSM https://www.bitchute.com/video/uoa7ubOn7NP3/ On the same day UK puppet / PM Boris Johnson and U.S. states (NC and others) announced "2nd wave" measures, Pfizer announced the rushed release of its DNA-altering vaccine with no oversight and a history of massive conflicts of interest. Coleman responds to Pfizer's claim that it has a "safe and effective" Covid-19 vaccine, given its sordid history. Plus: Face Mask Dangers of prolonged use - HOW SYMPTOMS of MASK-WEARING WILL BE BLAMED on COVID, and more... The Richie Allen Show Monday November 9th 2020 by The Richie Allen Show https://www.podomatic.com/podcasts/richieallen/episodes/2020-11-09T11_19_41-08_00

MANUFACTURING COLLAPSE https://www.bitchute.com/video/lsbctIKDm4VH/

How a Civil War Could Start! https://www.youtube.com/watch?v=6luFJvZt-og&feature=emb_logo

The Mirror Project - A Trustworthy Vaccine - Pfizer https://www.youtube.com/watch?v=al-SZ7cii-g&feature=emb_logo Take just 5 minutes to learn about the company behind the UK V.a.x coming soon

https://www.activistpost.com/2020/11/the-big-tech-exodus-has-begun-join-us.html

https://in-this-together.com/covid-19-evidence-of-global-fraud/

https://principia-scientific.com/did-big-tech-cia-steal-us-election-from-trump/

https://www.rt.com/business/506759-biggest-free-trade-deal/

https://www.ignatius-piazza-front-sight.com/2020/11/14/trumps-re-election-is-certain-constitutional-video-lesson-from-both-the-left-and-right-demonstrates-how-and-why/


http://tapnewswire.https://humansarefree.com/2020/11/davos-the-great-reset-and-the-plot-to-cancel-trump.html

com/2020/11/its-just-the-flu-its-all-bs-russias-top-official-covid-doctor-admits-in-bombshell-invu/


Watch : The Great Reset narrated by Laura Ingraham on The Angle, Fox News (Biden & The Global Reset) Joe Biden's COVID shutdown, globalist 'reset' plans will cripple American freedoms, economy. ttps://www.youtube.com/watch?v=So22oNOBTQc&feature=emb_logo

https://www.naturalnews.com/2020-11-16-coronavirus-5-times-deadlier-than-flu.html

https://www.globalresearch.ca/what-not-said-pfizer-coronavirus-vaccine/5729461

https://www.lewrockwell.com/2020/11/no_author/not-the-first-time-a-vitamin-deficiency-was-confused-for-a-viral-epidemic/


11-13

https://www.brighteon.com/64a46d81-3e4a-4945-b914-db215bf14d31 Emergency Update - Nov. 11th - SCOTUS will nullify the election, Congress will decide

The Health Ranger Report Daily News Update Nov. 12, 2020 https://www.brighteon.com/3ba88fb7-630e-489d-a2b2-0b67e3f78212

Pee: What Your Urine Color Means for Your Health https://draxe.com/health/pee-health/

America's Moment of Truth WotW analyses the post-election turmoil and explains why you should be backing the president - at least for now. https://www.youtube.com/watch?v=GwbTRmt8jDo&feature=emb_logo

America 2020 The Great PSYOP CRISIS https://www.youtube.com/watch?v=zlo8p1bSARc&feature=emb_logo

Many think: MK Ultra is a “secret CIA program” of the Americans and means MIND KONTROL, if actually the non-English NAME should raise questions! We should notice that MK Ultra already belongs to the Babylonian manipulation and is used today by the Pharaoh against the slaves! https://www.youtube.com/watch?v=QcjupKBdvGo Pharaonic, Babylonian MK Ultra in today's Society

How to Raise a Thriving Family - Dr. Danny Mendez D.C. https://www.youtube.com/watch?v=YoNWoM2NMB0

LINE UP FOR YOUR JAB TO GET YOUR COVAIDS FREEDOM PASS AND A 5% WORK FROM HOME TAX https://www.bitchute.com/video/eoQqlCgU65L2/


11-12

US ELECTION BAIT AND SWITCH? https://www.bitchute.com/video/Tb3rHsjaJyYi/ THE CROWHOUSE

THE DEADLY IMPACT OF LOCKDOWN The True Impact of Covid Lockdown; Pfizer Declares Victory?; Return of #Vaxhole of the Week!; ICAN introduces The High Road Project https://www.bitchute.com/video/BaTSybmYWOuS/ The Highwire with Del Bigtree

https://www.podomatic.com/podcasts/tkelly6785757/episodes/2020-11-12T03_56_17-08_00 Charlie Robinson returns to Our Interesting Times to discuss his new book The Controlled Demolition of the American Empire: From the Founding of the Federal Reserve, to 9/11, to the Coronavirus Panic which he co-wrote with Jeff Berwick. Charlie is also the author of The Octopus of Global Control and the host of the Microaggressions podcast.

BOOM! TRUMP TWEETS: REPORT: DOMINION DELETED 2.7 MILLION TRUMP VOTES NATIONWIDE. DATA ANALYSIS FINDS 221,000 PENNSYLVANIA VOTES SWITCHED FROM PRESIDENT TRUMP TO BIDEN http://tapnewswire.com/2020/11/boom-trump-tweets-report-dominion-deleted-2-7-million-trump-votes-nationwide-data-analysis-finds-221000-pennsylvania-votes-switched-from-president-trump-to-biden/

How the COVID-19 Vaccine Can … Destroy Your Immune System http://tapnewswire.com/2020/11/how-the-covid-19-vaccine-can-destroy-your-immune-system/


President Trump and Republicans have a card to play http://www.informationclearinghouse.info/55855.htm

https://www.anti-empire.com/lockdowns-hysteria-will-have-caused-an-additional-200000-400000-tb-deaths-in-2020-alone/

CAUGHT! Election data analyzed, producing detailed list of over 500,000 votes SWITCHED from Trump to Biden via voting machine software theft, with heavy fraud focused on swing states On election night, President Trump and hand-selected DoD personnel were sitting in secure command room, watching and documenting the entire election theft taking place in real time. All the vote theft was recorded in detail, and this vote theft was allowed to take place so that deep state treasonous actors could be caught in the act. https://www.naturalnews.com/2020-11-11-election-data-analyzed-votes-switched-biden-software.html


COVID Truths, COVID Lies Dr. Andrew Kaufman is an American natural healing consultant, inventor, expert witness and forensic psychiatrist who has been powerfully outspoken throughout the pandemic. Speaking counter to the mainstream media, Dr. Kaufman has stated that a virus is not causing a new disease, there is no evidence of increased mortality and modern medicine is the leading cause of death. Having studied at MIT, Duke and the Medical University of South Carolina, he has published original research and lectured, supervised, and mentored medical students in all psychiatric specialties. His knowledge and experience has qualified you as an expert witness in local, state, and federal courts. Show highlights: The particles coming off dying cells are said to be viruses, but what about exosomes? What are they and how they fit into the pandemic picture; the science is actually clear, just suppressed What creates exosomes? What is their purpose? Can we share exosomes with others through coughing, sneezing, etc The problem with testing for COVID Dr. Kaufman has been one of our favorite docs to follow since the pandemic hit; he makes so much sense Patrick asks Dr. Kaufman about ‘germ theory’ Now is the time to start looking outside the allopathic model Concerning viruses, what’s happening in a laboratory doesn’t necessarily correlate to what’s happening in a person How big pharma hijacked healthcare; creating new vaccines by creating new viruses So is there evidence of a new disease? Have there been a rise in mortality worldwide this year? The answer is ‘no’. Dr. Kaufman elaborates on the numbers People have been killed for no reason through poor protocols https://oneradionetwork.com/all-shows/dr-andrew-kaufman-covid-truths-covid-lies-november-11-2020/

Hammer and Scorecard: ABC, CBS, CNN, NBC live data feed .json analysis for dummies https://www.youtube.com/watch?v=X1uyg1f0RNA&feature=emb_logo


https://jamesperloff.com/2020/11/12/would-the-deep-state-use-a-biden-presidency-to-pull-a-nelson-rockefeller/

THERE IS NO VIRUS - WHEN THAT PENNY DROPS, ALL ELSE FOLLOWS - DAVID ICKE DOT-CONNECTOR https://www.bitchute.com/video/dcOOEOXSUBqG/

DAVID ICKE TALKS WITH OUT-OF-THE-BOX THINKER AND DOCTOR TOM COWAN, AUTHOR OF THE CONTAGION MYTH https://www.bitchute.com/video/421Daim8s5mI/


The Great Reset” Already Happened

NOVEMBER 12, 2020

By Charles Hugh Smith

Put another way: the elites have cannibalized the system so thoroughly that there’s nothing left to steal, exploit or cannibalize.

The global elites’ techno-fantasy of a completely centralized future, The Great Reset, is addressed as a future project. Too bad it already happened in 2008-09. The lackeys and toadies tasked with spewing the PR are 12 years too late, and so are the critics listening to the PR with foreboding.

Simply put, events outran our understanding of them. The future already manifested while we were trying to cram the present arrangement into an obsolete conceptual framework.

In broad-brush, the post-World War II era ended around 1970. The legitimate prosperity of 1946-1970 was based on cheap oil controlled by the U.S. and the hegemony of the U.S. dollar. Everything else was merely decoration.

The Original Sin to hard-money advocates was America’s abandonment of the gold standard in 1971, but this was the only way to maintain hegemony. Maintaining the reserve currency is tricky, as the nation issuing the reserve currency has to supply the global economy with enough of the currency to grease commerce and stock central bank reserves around the world.

As the global economy expanded, the only way the U.S. could send enough dollars overseas was to run trade deficits, which in a gold standard meant the gold reserves would go to zero as trading partners holding dollars would exchange the currency for gold.

So the choice was: give up the reserve currency and the hegemony of the U.S. dollar by jacking up the dollar’s value so high that imports would collapse, or accept that hegemony was no longer compatible with the gold standard. It wasn’t a difficult decision: who would give up global hegemony, and for what?

Many other dynamics changed around the same time: social, cultural, political. These charts reflect the end of the postwar era and the ushering in of a new era.

Again in broad-brush, the key economic dynamic was the decline of labor’s share of the economy in favor of capital. Those who had only their labor to sell lost purchasing power, while those who could borrow or access capital benefited enormously. The charts below tell the story: labor’s share of the national income has stairstepped lower for 50 years (since 1970) while the super-wealthy’s share has outpaced everyone else 15-fold.

The dominance of financial capital is visible in the third chart, as private-sector financial assets are now 6 times the nation’s GDP, double the percentage of the postwar era.

This capital-friendly era was rocket-boosted by financialization in the 1980s, technology in the 1990s and globalization in the early 21st century. You can see each advance of capital’s top tier–the top 0.1%–in the chart below: the top 0.1% first pulled away in the 1980s financialization, stutter-stepped in the early 1990s and then exploded higher as technology fueled capital’s leverage and exposure to the gains reaped by computers and the Internet.

Alas, these extremes are not stable or sustainable, and so each wave ends in a devastating crash. The income of the top 0.1% took a hit as the dotcom bubble burst, but then China’s entry into the WTO saved the day as rampant globalization and additional extremes of financial leverage and fraud boosted their fortunes in the 2000s.

The dual extremes of financialization and globalization created the 2008 bubble, and its collapse almost took down the entire global capital house of cards. Central banks, ultimately financed by the Fed to the tune of $29 trillion, twice the size of America’s entire GDP, instituted The Great Reset under the usual guise of “emergency measures” which then became permanent policies.

The Great Reset led to the hyper-centralization of control over the global economy’s money as central banks coordinated unprecedented money-printing and financial repression, which includes zero-interest rate policies (ZIRP), as the debt-bubble would pop if rates aren’t nailed down to zero.

All the PR being spewed about The Great Reset is the final frantic flailing of a system that’s drowning in its own excesses. The 50-year long era of the few enriching themselves as the expense of the many has ended, for the same reason eras of extreme exploitation always end–the elites got too greedy and overshot the economy’s ability to sustain their rapidly expanding share of the income and wealth.

Put another way: the elites have cannibalized the system so thoroughly that there’s nothing left to steal, exploit or cannibalize. The hyper-centralized global money control has run out of rope as the cheap oil is gone, debts have ballooned to the point there is no way they’ll ever be paid down, and the only thing staving off collapse is money-printing, which holds the seeds of its own demise.

Allow me to summarize the only way The Great Reset envisioned by global elites can actually manifest: The Martians arrive towing huge meteorites of pure lithium and gold, and rather than incinerating the global elites, they hand the global elites the meteorites to further their concentration of wealth and power.

Short of that science fiction, this sucker’s going down. The Great Reset has already run its course after 12 long years of artifice, fraud and trickery. So global elite shills, lackeys, factotums, toadies and apparatchiks–prepare for your Wil-E-Coyote moment of truth.

Vaccines - The Oldest Scam

November 12, 2020

In 1988, Eustace Mullins blew the whistle on the vaccine scam.

Not only do drugmakers make huge profits from vaccines, but they continue to profit from the illnesses they cause.

If vaccines weren't harmful to health, why would pharmaceutical companies be exempt from liability?

This goose has been laying a golden egg for more than a century, at an indescribable toll in human suffering.

Now they want to make vaccinations - not one but regular shots -- a condition for participation in society and freedom.

"The practice of medicine may not be the world's oldest profession, but it is often seen to be operating on much the same principles."

Eustace Mullins

Excerpts from Murder by Injection (1988)

by Eustace Mullins

(henrymakow.com)

Despite the great power of the hidden rulers, I found that only one group has the power to issue life or death sentences to any American -- our nation's physicians.

I discovered that these physicians, despite their great power, were themselves subjected to very strict controls over every aspect of their professional lives. These controls, surprisingly enough, were not wielded by any state or federal agency, although almost every other aspect of American life is now under the absolute control of the bureaucracy. The physicians have their own autocracy, a private trade association, the American Medical Association. This group, which is headquartered in Chicago, Illinois, had gradually built up its power until it assumed total control over medical schools and the accreditation of physicians.

----------------

From its earliest inception [in 1847], the American Medical Association has had one principal objective, attaining and defending a total monopoly of the practice of medicine in the United States. From its outset, the AMA made allopathy the basis of its practice. Allopathy was a type of medicine whose practitioners had received training in a recognized academic school of medicine, and who relied heavily on surgical procedures and the use of medications.

--

1679-eustace-mullins.jpg

(Eustace Mullins 1923-2010)

The practice of immunization goes directly against the discovery of modern holistic medical experts that the body has a natural immune defense against illness. The Church of Modern Medicine claims that we can only be absolved from the peril of infection by the Holy Water of vaccination, injecting into the system a foreign body of infection, which will then perform a Medical Miracle, and will confer life-long immunity, hence the term, "immunization." The greatest heresy any physician can commit is to voice publicly any doubt of any one of the Four Holy Waters, but the most deeply entrenched in modern medical practice is undoubtedly the numerous vaccination programs. They are also the most consistently profitable operations of the Medical Monopoly. Yet one physician, Dr. Henry R. Bybee, of Norfolk, Virginia, has publicly stated, "My honest opinion is that vaccine is the cause of more disease and suffering than anything I could name. I believe that such diseases as cancer, syphilis, cold sores and many other disease conditions are the direct results of vaccination. Yet, in the state of Virginia, and in many other states, parents are compelled to submit their children to this procedure while the medical profession not only receives its pay for this service, but also makes splendid and prospective patients for the future." (p.79) --

Another practitioner, Dr. W. B. Clarke of Indiana finds that "Cancer was practically unknown until compulsory vaccination with cowpox vaccine began to be introduced. I have had to deal with a least two hundred cases of cancer, and I never saw a case of cancer in an unvaccinated person." (p.81)

--

Another well-known medical practitioner, Dr. J. M. Peebles of San Francisco, has written a book on vaccine, in which he says,

"The vaccination practice, pushed to the front on all occasions by the medical profession through political connivance made compulsory by the state, has not only become the chief menace and the greatest danger to the health of the rising generation, but likewise the crowning outrage upon the personal liberties of the American citizen; compulsory vaccination, poisoning the crimson currents of the human system with brute-extracted lymph under the strange infatuation that it would prevent smallpox, was one of the darkest blots that disfigured the last century."

Dr. Peebles refers to the fact that the cowpox vaccine was one of the more peculiar "inventions or discoveries of the Age of Enlightenment." However, as I have pointed out in "The Curse of

Canaan," the Age of Enlightenment was merely the latest program of the Cult of Baal and its rituals of child sacrifice, which, in one guise or another, has now been with us for some five thousand years. Because of this goal, the Medical Monopoly is also known as "The Society for Crippling Children." (p.81-82)

However, the peril of even one state legislature foiling their criminal conspiracy caused the Rockefeller Syndicate to concentrate on perfecting an instrument for controlling each and every state legislature in these United States. This was achieved by setting up the Council of State Governments in Chicago. Its ukases are routinely issued to every state legislator, and such is its totalitarian control that not one legislature has ever failed to follow its dictates.

Edward Jenner (1796-1839) "discovered" that cowpox vaccine would supposedly inoculate persons against the eighteenth-century scourge of smallpox. In fact, smallpox was already on the wane, and some authorities believe it would have vanished by the end of the century, due to a number of contributing factors. After the use of the cowpox vaccine became widespread in England, a smallpox epidemic broke out which killed 22,081 people. The smallpox epidemics became worse each year that the vaccine was used. In 1872, 44,480 people were killed by it. England finally banned the vaccine in 1948, despite the fact that it was one of the most widely heralded "contributions" which that country had made to modern medicine. This action came after many years of compulsory vaccination, during which period those who refused to submit to its dangers were hurried off to jail. (p. 83) ----Polio has increased 700% in states which have compulsory vaccination. The much-quoted writer on medical problems, Morris Beale, who for years edited his informative publication, Capsule News Digest, from Capitol Hill, offered a standing reward during the years from 1954 to 1960 of $30,000, which he would pay to anyone who could prove that the polio vaccine was not a killer and a fraud. There were no takers.

Medical historians have finally come to the reluctant conclusion that the great flu "epidemic" of 1918 was solely attributable to the widespread use of vaccines. It was the first war in which vaccination was compulsory for all servicemen. The Boston Herald reported that forty-seven soldiers had been killed by vaccination in one month. As a result, the military hospitals were filled, not with wounded combat casualties, but with casualties of the vaccine. The epidemic was called "the Spanish Influenza," a deliberately misleading appellation, which was intended to conceal its origin. This flu epidemic claimed twenty million victims; those who survived it were the ones who had refused the vaccine. In recent years, annual recurring epidemics of flu are called "the Russian Flu." For some reason, the Russians never protest, perhaps because the Rockefellers make regular trips to Moscow to lay down the party line.

The perils of vaccination were already known. Plain Talk magazine notes that "during the Franco-Prussian War, every German soldier was vaccinated. The result was that 53,288 otherwise healthy men developed smallpox. The death rate was high."

In what is now known as "the Great Swine Flu Massacre," the President of the United States, Gerald Ford, was enlisted to persuade the public to undergo a national vaccination campaign. The moving force behind the scheme was a $135 million windfall profit for the major drug manufacturers. They had a "swine flu" vaccine which suspicious pig raisers had refused to touch, fearful it might wipe out their crop. The manufacturers had only tried to get $80 million from the swine breeders; balked in this sale, they turned to the other market, humans. The impetus for the national swine flu vaccine came directly from the Disease Control Center in Atlanta, Georgia. Perhaps coincidentally, Jimmy Carter, a member of the Trilateral Commission, was then planning his presidential campaign in Georgia. The incumbent President, Gerald Ford, had all the advantages of a massive bureaucracy to aid him in his election campaign, while the ineffectual and little known Jimmy Carter offered no serious threat in the election.

Suddenly, out of Atlanta, came the Center of Disease Control plan for a national immunization campaign against "swine flu." The fact that there was not a single known case of this flu in the United States did not deter the Medical Monopoly from their scheme. The swine breeders had been shocked by the demonstrations of the vaccine on a few pigs, which had collapsed and died. One can imagine the anxious conferences in the headquarters of the great drug firms, until one bright young man remarked, "Well if the swine breeders won't inject it into their animals, our only other market is to inject it into people."

The Ford sponsored swine flu campaign almost died an early death, when a conscientious public servant, Dr. Anthony Morris, formerly of HEW and then active as director of the Virus Bureau at the Food and Ding Administration, declared that there could be no authentic swine flu vaccine, because there had never been any cases of swine flu on which they could test it. Dr. Morris then went public with his statement that "at no point were the swine flu vaccines effective." He was promptly fired, but the damage had been done. (84-85)

Lockdowns, Hysteria Will Have Caused an Additional 200,000-400,000 TB Deaths in 2020 Alone

"TB is the world’s leading cause of death from infectious disease. It is contagious"

Robin McKie 9 Nov 20 556

Scientists have warned that several hundred thousand extra deaths from tuberculosis are likely to occur this year as a result of Covid-19’s [response] effect on global health services.

In many countries – including South Africa, India and Indonesia – doctors and health workers have been shifted from tracking TB cases to tracing people infected with Covid-19. Equipment and budgets have also been reassigned, [to say nothing of the loss of mobility, access to health, or turning away of patients] an investigation by the World Health Organisation (WHO) has revealed.

As a result, millions of TB diagnoses have been missed, and according to the WHO this is likely to result in 200,000 to 400,000 excess deaths from the disease this year alone, with a further million new cases occurring every year after that for the next five years.

“This is just one example of the very difficult choices that had to be taken to contain Covid-19,” said Thomas Kenyon, chief health officer of Project Hope, the humanitarian NGO. “It was obviously crucial that we tackle the pandemic but we cannot forget that we have other killers in our midst. We are going to have to be innovative in addressing them.”

TB is the world’s leading cause of death from infectious disease, topping both HIV and malaria. It is contagious and is caused by a bacterium known as Mycobacterium tuberculosis, which commonly attacks the lungs but can affect any part of the body, from the bloodstream to the brain.

Humanity has lived with the threat of TB for millennia. The ancient Egyptians knew of its dangers and it is believed that Nefertiti and her Pharaoh husband Akhenaten both died from tuberculosis in around 1330 BC.

In modern times TB has become a global scourge and it is believed that about 10 million people are infected with the disease each year, while about 1.5 million people die from it. The WHO says the planet is now in the grip of global TB epidemic, which it has pledged to defeat by 2030. The condition can be treated using a six-month drug regime – provided a diagnosis is made in time. Major efforts to contain the disease began in 2015. At first, efforts to contain it were successful and the number of deaths began to fall. This decline has slowed recently. One problem has been the spread of antibiotic-resistant strains of TB, particularly in nations that made up the former Soviet Union.

With the arrival of Covid-19, the global battle against TB received a further setback. According to the WHO, problems have arisen not just because key staff have been reallocated from TB tracing to Covid testing but also because critically important equipment and materials have been redeployed. In addition, some countries have cut inpatient and outpatient care for TB sufferers.

A particular problem has arisen in relation to a test called GeneXpert, which is efficient at identifying the molecular signature of Mycobacterium tuberculosis in people with TB. The test is also very good at identifying individuals who have Covid-19.

“Many countries have changed to using GeneXpert machines for Covid-19 testing instead of diagnostic testing for TB,” reported WHO, which said it had also found numerous examples of staff reassignment and reallocation of budgets from TB to Covid work.

In India, Indonesia, the Philippines and South Africa – which account for 44% of all global TB cases – this led to large drops in the number of people diagnosed with the disease between January and June this year. “As a result, the global number of TB deaths could increase by around 0.2–0.4 million in 2020 alone,” the WHO report predicts.

It adds that [the insane response to] Covid-19 is likely to affect the world’s TB epidemic in two other key ways: GDP per capita and undernutrition. “Modelling has suggested that the number of people developing TB could increase by more than one million per year in the period 2020–2025. The impact on livelihoods resulting from lost income or unemployment could also increase the percentage of people with TB and their households facing catastrophic costs.”

This point was backed by Kenyon. “We have to face the fact that we are going to get a lot of deaths caused directly by Covid, but we also have to realise we are going to get a lot of deaths caused indirectly by the [insane response to the] disease,” he said.

Source: The Guardian

CAUGHT! Election data analyzed, producing detailed list of over 500,000 votes SWITCHED from Trump to Biden via voting machine software theft, with heavy fraud focused on swing states

Wednesday, November 11, 2020 by: Mike Adams

Tags: CIA, cyber war, deep state, dominion, election faud, fraud, Glitch, Joe Biden, President Trump, rigged, vote theft, voting machines

Bypass censorship by sharing this link:

New

https://www.distributednews.com/473589.html

Copy URL

29K

VIEWS

Image: CAUGHT! Election data analyzed, producing detailed list of over 500,000 votes SWITCHED from Trump to Biden via voting machine software theft, with heavy fraud focused on swing states

(Natural News) An analysis of the raw voting data dumps from the 2020 election, carried out by user “Centipede” (“PedeInspector”) at TheDonald.win, reveals bombshell news.

It appears that hundreds of thousands of votes were switched from Trump to Biden via the software control systems of the voting machines. This was done in real time, during election night, which also explains why election counting was slowed in swing states in order to allow the election theft to be coordinated and executed.

PedeInspector explains how he wrote a script to detail all the instances of votes being lost or switched from Trump to Biden. His data source is the NYT raw data dump feed at the following link (which may not function once the NYT pulls it):

https://static01.nyt.com/elections-assets/2020/data/api/2020-11-03/race-page/michigan/president.json

As The Gateway Pundit explains:

The author also claims that the data is from Edison Research and it is the same data that is used for election coverage by at least ABC News, CBS News, CNN and NBC News. It is also used for the website of the NYT, and probably others as well.

This json data feed is like a transaction log file. It shows each update to the voting totals, like a Flight Data Recorder (“Black Box”) on a commercial airliner.

He shows what one of the data switches looks like:

Explanation: This graphic shows two updates on voting totals. #27 and #28:

For #27:

Trump votes = .578 x 573857 = 331,689

Biden votes = .401 x 573857 = 230,117

For #28:

Trump votes = .568 x 574417 = 326,269 (it went DOWN for Trump by 5,420 votes)

Biden votes = .406 x 574417 = 233,213 (it went UP for Biden by 3,096 votes)

As you can see, votes were taken from Trump and added to Biden. In this case it was only a few thousand, but there were thousands of other vote switch transactions in the log files.

Understand that this is absolute proof of software-based vote theft. (See more details below.)

This is like having the black box recorder recovered after a jet crash. All the data are intact. The election was stolen over the ‘net, in real time.

A detailed list of the vote theft results

This list is organized by voting systems (voting software brands). We are highlighting the swing states in particular, so notice how the special emphasis on vote theft focused on these states.

Dominion Voting Systems :

Pennsylvania : Switched : 220,883 Lost Votes : 941,248

New Jersey : Switched : 80,242 Lost Votes : 20

Florida : Switched : 21,422 Lost Votes : 456

Michigan : Switched : 20,213 Lost Votes : 21,882

New York : Switched : 18,124 Lost Votes : 623,213

Georgia : Switched : 17,407 Lost Votes : 33,574

Ohio : Switched : 14,965 Lost Votes : 5,102

Virginia : Switched : 12,163 Lost Votes : 789,023

California : Switched : 7,701 Lost Votes : 10,989

Arizona : Switched : 4,492 Lost Votes : 0

Minnesota : Switched : 2,766 Lost Votes : 195,650

Tennessee : Switched : 2,330 Lost Votes : 0

Louisiana : Switched : 2,322 Lost Votes : 0

Illinois : Switched : 2,166 Lost Votes : 54,730

Wisconsin : Switched : 2,078 Lost Votes : 3,408

Colorado : Switched : 1,809 Lost Votes : 0

Utah : Switched : 1,627 Lost Votes : 0

New Hampshire : Switched : 973 Lost Votes : 116

Iowa : Switched : 938 Lost Votes : 477

New Mexico : Switched : 268 Lost Votes : 4,610

Missouri : Switched 0 : Lost Votes : 20,730

Nevada : Switched : 0 Lost Votes : 0

Alaska : Switched : 0 Lost Votes : 0

Washington : Switched : 0 Lost Votes : 0

Hawaii : Switched : 0 Lost Votes : 0

Kansas and Texas use Premier Election Solutions, owned by Dominion Voting Systems.

Texas : Switched : 14,954 Lost Votes : 30,557

Kansas : Switched : 1,674 Lost Votes : 2,154

Election Systems & Software :

Nebraska : Switched : 30,086 Lost Votes : 50

Kentucky : Switched : 8,129 Lost Votes : 23,849

Arkansas : Switched : 3,664 Lost Votes : 20,748

South Carolina : Switched : 2,779 Lost Votes : 2,119

Montana : Switched : 2,330 Lost Votes : 1,276

South Dakota : Switched : 1,347 Lost Votes : 1

North Dakota : Switched : 234 Lost Votes : 681

Maryland : Switched : 203 Lost Votes : 0

North Carolina : Switched : 0 Lost Votes : 15

District of Columbia : Switched : 0 Lost Votes : 0

Unknown Systems:

Nebraska : Switched : 30,086 Lost Votes : 50

Connecticut : Switched : 3,834 Lost Votes : 272

Massachusetts : Switched : 3,613 Lost Votes : 51

Oregon : Switched 2,557 Lost Votes : 0

Alabama : Switched : 1,170 Lost Votes : 408

Mississippi : Switched : 355 Lost Votes : 0

Maine : Switched : 271 Lost Votes : 35

Rhode Island : Switched : 6 Lost Votes : 13

West Virginia : Switched : 0 Lost Votes : 78,300

Idaho : Switched 0 Lost Votes : 0

Oklahoma : Switched : 0 Lost Votes : 0

Indiana : Switched : 0 Lost Votes : 0

Delaware : Switched : 0 Lost Votes : 0

Vermont : Switched : 0 Lost Votes : 0

Rudy Giuliani confirms that Dominion software people are stepping forward as whistleblowers

In yet more shocking news that will change the course of history, Rudy Giuliani has now confirmed, during a live broadcast with Steve Bannon’s “Warroom” program, that Dominion software witnesses are stepping forward and blowing the whistle on the massive vote theft fraud:

Without the vote fraud, Trump wins with 307 electoral votes

The website EveryLegalVote.com shows the real election results once you remove all the vote theft.

Without vote theft: Trump wins with 307 electoral votes.

With vote theft: Biden wins with 304 electoral votes.

Fraud has been detected and documented in nearly all the swing states, including PA, MI, WI, GA and VA:

See full details at EveryLegalVote.com

Source reveals that the CIA ran the vote theft while Trump and the DoD documented the entire election coup

Yesterday, sources told us that the CIA was in charge of running the vote theft operation, with Gina Haspel deeply involved in straight up treason. On election night, President Trump and hand-selected DoD personnel were sitting in secure command room, watching and documenting the entire election theft taking place in real time.

All the vote theft was recorded in detail, and this vote theft was allowed to take place so that deep state treasonous actors could be caught in the act.

Big Tech, the mainstream media and the CIA are all conspiring to try to gaslight the nation and falsely claim that Biden won, even as they all know the election was stolen via voting machine software theft. This is why they are rushing to remove Trump from office right now, with John Brennan, Obama’s former CIA director, practically crapping himself on live TV and demanding Trump be immediately removed via the 25th Amendment.

That’s because Brennan and the other deep state actors know they’ve been caught. Trump has all the evidence. In fact, he has a detailed transaction log showing the fraud playing out in real time.

In the coming weeks, this information will be presented to the U.S. Supreme Court. We anticipate SCOTUS will invalidate the presidential election and kick the outcome back to Congress, where each state gets one vote to choose the next President. Republicans have a strong majority in the number of state legislatures they control, and they will easily win that vote. (Nancy Pelosi may refuse to allow the vote to take place, but if she does, she will be arrested for treason.)

Trump has fired former Defense Secretary Mark Esper and is cleaning house at the DoD in order to get the Pentagon ready for military arrests of the traitors who carried out this engineered election theft.

Hundreds (or thousands) of people will eventually be arrested and charged with various crimes, including conspiracy and sedition. Many of the deep state players who worked under Obama will go to prison once this is all said and done.

The insane, radical Left-wing lunatics in America will explode with rage and violence once the election is announced for Trump, and this will almost certainly lead to President Trump invoking the Insurrection Act and deploying troops on the streets to take down left-wing terrorists. At this time, America will be plunged into significant chaos and violence, which is sadly unavoidable as part of the process of draining the swamp and putting down left-wing terrorists.

All American patriots are advised to double check their rifles, ammo and red dot sights. This situation is absolutely going kinetic, most likely within the next 70 days. But the good news is that Trump holds all the cards and has all the evidence of vote theft that he needs to win.

Listen to my emergency podcast from Nov. 11th for a full explanation of what happens next: SCOTUS, Congress, Nancy Pelosi, military police and more. This is my current best estimate of where this goes and how Trump wins the election and defeats the deep state:

Almost No One Else Will Say It, So I Must

Published: Thursday, November 12, 2020

Download free computerized mp3 audio file of this column

I will refrain from making comments about the presidential election itself until after it has been officially decided.

In the meantime, however, there is much to be said about how we got here. And, once again, it is left to me to say what almost no one else is willing to say.

First, had Donald Trump followed through with his promise to drain the swamp, we would not even be in this fix. Trump had four years to take care of the Clinton/Biden criminal cartel, and he did absolutely NOTHING.

Instead, Trump surrounded himself with the same old establishment Deep State CFR globalists as did his predecessors Bush I, Clinton, Bush II and Obama. In fact, Trump appointed more globalist fellow travelers during his first term in office than did his predecessors in a comparable period.

In other words, we can thank Donald Trump himself for the current crisis unfolding in Washington, D.C. We wouldn’t even be thinking about Creepy Biden had Trump kept his promise to drain the swamp. And it’s maddening that evangelicals and conservatives can’t seem to figure that out.

Second, while conservatives are rightly concerned about Kamala Harris, almost none of them seem to know the real reason why she is so worrisome.

Let me lay a foundation with this report:

Well, firstly there’s Biden’s age to consider. He’ll be 82 at the end of his first term and it’s widely predicted he’ll call it quits then. Sources close to him suggested so last year, and CNN’s Anderson Cooper and Obama’s former campaign manager David Axelrod have both expressed this view in the past few days. In that scenario, Harris would be a front-runner to take over.

It is particularly telling that Axelrod has spoken out, as he is incredibly well-connected inside the Democrat apparatus.

Harris is being positioned now to take over in 2024 and win again in 2028. She’s just turned 56, so her age is not an issue, and she is being groomed to appear presidential. How else would someone go from being a basket case of a candidate to a highly-respected national figure in a matter of months?

You can see the behind the scenes string-pulling, like how her husband Douglas Emhoff is being hailed as the first Jewish second gentleman; no Jew has ever been part of America’s first or second couples.

But the real focus should be on Emhoff’s job. He works for multinational law firm DLA Piper in Washington, which also undertakes lobbying work. The couple are reported to comfortably be millionaires, and are very much part of the establishment.

The Democratic establishment know she is one of them and are plotting her course, and we can expect to see her afforded a higher profile than other VPs over the next four years.

Because Kamala Harris is being lined up as the 47th President of the United States.

The Zionist Connection

Harris’ husband is a mega-wealthy lobbyist and litigator who made his fortune promoting and defending the socialist/Marxist agenda within the entertainment and media industries, which we all know are dominated by Zionists.

Here is the big disconnect among evangelical Christians and conservatives: They don’t understand that socialism, Marxism, communism and Zionism are one and the same. I repeat: They are one and the same. (And all of it depends on the undergirding financial assistance from their mega-rich partners of crony capitalists.)

Karl Marx was a Zionist. Joseph Stalin was a Zionist. Vladimir Lenin was a Zionist. The communist revolution in Russia was a Zionist-led revolution. And the push for Marxism in America today is being facilitated by powerful Zionist toadies such as Kamala Harris’ husband, Douglas Emhoff.

As for Donald Trump, he did more to promote Zionism than any other president in U.S. history. Behind the scenes, Trump's Zionist daughter Ivanka and Zionist son-in-law Jared Kushner constantly pushed the Zionist agenda in Trump’s foreign and domestic policies.

So where is God’s blessing on America now for all of Trump’s blessings on Israel?

For four years, Christians have been saying that Donald Trump was a John the Baptist-type figure—a forerunner of Christ. They had it half right. He was a forerunner alright: not for Christ but for the antichrist figures within the Harris family.

Maybe that’s why, when the entire country was emotionally embroiled (to put it mildly) in the most divisive presidential election in history, Trump was casually playing golf last weekend. He knows the plan (and the planners) and his part in it.

Until Christians and conservatives come to understand that by supporting the Zionist State of Israel they are supporting the Marxist takeover of America, that takeover will continue unabated.

Zionism is not a race; neither is it a nationality nor a religion. Zionism is a political philosophy—the philosophy of atheistic collectivism. The Zionist state in Palestine is an elaborate stratagem that provides a convenient shield against criticism. Any critique of Zionism—even when it comes from Jewish rabbis—is labeled as “anti-Semitism.”

From the days of the Bolshevik Revolution in Russia, Zionists (communists) have used political upheaval, chaos, disorder, violence, hatred, division, historical and cultural cleansing, etc., to accomplish their takeovers of countries.

Had Trump been genuine about wanting to rid America of the swamp creatures in Washington, D.C., and had he used the immense power of his office to bring the known criminals such as Joe Biden and Hillary Clinton (and the myriad support staff in their criminal network) to justice, there would have been no Joe Biden to run against, and he would have easily won a second term in a landslide election.

Wake up, folks! Donald Trump brought this on himself. We can debate all day long whether he did it wittingly or unwittingly, but there is no denying the fact that by his refusal to drain the swamp, he brought this on himself—and on the rest of us.

By the way, under cover of a heated presidential election, the State of Israel continued to push forward with its ethnic cleansing (now called “annexation”) of Palestine.

Here is the report of how Israel wiped an entire Palestinian community off the map. Israel has annihilated hundreds of Palestinian towns, villages, districts and communities since 1948.

That’s why Benjamin Netanyahu already congratulated Joe Biden on an election victory—even before the election was firmly decided. He is keenly aware of the exponential rise in Zionist power and influence that accompanies the Harris family rise to the White House.

Amazingly, many evangelicals continue to stupidly believe that Netanyahu (and Zionism itself) is a friend of the United States and a friend of Christianity. What dupes!

In a real sense, the rise of the Marxist attack against America, personified in Kamala Harris, can be, at least partially, attributed to the misguided support for Zionism among our evangelical churches.

As I said, almost no one else will say it, so I must.

P.S. I again urge readers to get the Must-Read book entitled The Ethnic Cleansing Of Palestine, by Ilan Pappe.

This is the true story of how Israel became a state off the blood, rape and ethnic cleansing of the Palestinian people—an ethnic cleansing that continues today, as I reported in this column.

The State of Israel loves to play the role of victim on the world stage, but the truth is, since WWII, Israel is one of the most murderous aggressor/terror states in the world. Had any other nation on earth committed the atrocities you will find documented in this book, the entire world—especially the United States—would hold it up to global condemnation. But you have likely read or heard absolutely nothing about it. The truth of Israel's murderous conquest of Palestine is even hidden from the people of Israel themselves.

Evangelical Christians who are enamored with the modern State of Israel, believing it to be a fulfillment of Biblical prophecy, need to take a close, hard look at the brutal history of the Zionist state. Reading this book is the best place to begin.

Order The Ethnic Cleansing Of Palestine by Ilan Pappe here.

P.S.S. Plus, I want to again announce that we are now shipping the Matthew Henry Study Bible.

For years, people who watch my online messages have been asking me to recommend a study Bible. This I was not able to do, because every comprehensive study Bible I knew of taught the false doctrines of Christian Zionism. The only study Bible I knew of that was NOT Zionist-based was the Matthew Henry Study Bible.

Well, the new printing of the Matthew Henry Study Bible has just arrived, and they are NOW AVAILABLE.

If somehow the Church could extricate itself from the false doctrines of Christian Zionism, I truly believe God would restore both Liberty and Revival to our land. The Bible commentaries of Matthew Henry and other pre-Scofield Bible scholars in bygone centuries gave birth to the patriot pastors and preachers of Colonial America that brought a Great Awakening—and then a revival of Liberty—to this country.

Ask yourself: What has one hundred years of our pastors and churches preaching the false doctrines of Christian Zionism (what an oxymoron!) done for America? Do you think there is a connection between the increase of this false teaching and the decrease of true Christianity in this country? I do!


MathisderMalersaid:November 14, 2020 at 10:56 pm

Don’t think so Rolle. I gauge it by the pressure I feel on my own head from the media coverage, which is a pressure to move to Trump and the Reds. I find that pressure extraordinary, given everything. I have always hated the Reds intensely, and never liked Trump. But recent events push me strongly away from the Blues and toward the Reds. Why? Because the Blues are now far more fascist than the Reds. It is beyond belief to someone like me (someone my age with my experience), but the Reds are now more liberal than the Blues.

That is taking into account the fact that they flipped/switched the terms, and conservative now means liberal. The Blues have no concern for civil liberties, so how can they claim to be liberal? Just because they claim to support minorities doesn’t make them liberal. The way the BLues and the media have lied about everything in this election is also a big turnoff, and I think it is meant to be. You will say we have always been swimming in a sea of lies, which is true, but the sea is higher and more obvious than it has ever been. They didn’t even try to make this election look real. In fact, I think they made it look unreal and stolen on purpose.

All of which confirms my original theory: the Dems are being purposely blackwashed here. Yes, a few dopes may drink the current koolaid, missing anything deeper, but I think a lot of average people are seeing it. The numbers of Infowars and NaturalNews have jumped recently, after being depressed for a while, which pushes us in the same direction. People weren’t buying what they were selling a couple of years ago, but now that they are writing about election fraud, their numbers have caught fire.

People can see they aren’t getting any good information from the mainstream, so they are going elsewhere. If the governors are trying to create more complacency with all this, I have to say they are going about it in the wrong way. They are definitely creating more fear, but that doesn’t lead to complacency. You create complacency with a 1950s scheme of stability and content. You do not create it with massive unemployment, food shortages, draconian “laws”, and obvious lies 24/7.

The U.S. Government and its Military Have Declared War on the American People

By Gary D. Barnett

November 14, 2020

“Although tyranny…may successfully rule over foreign peoples, it can stay in power only if it destroys first of all the national institutions of its own people.”

~ Hannah Arendt

In order for tyrants to claim and retain total power, the people must become ignorant of their own history and roots, and must through propaganda and fear be so terrified as to abandon all logic and responsibility in order to seek a false safety. In this country today, history and tradition are being destroyed, while the ruling class and government have stoked immense fear based on a propaganda campaign that was used to create a make-believe threat called Covid-19. Every element is now in place to transfer all power to the state, and in order for that coup to be successful for the tyrants, all dissent and disobedience to totalitarian mandates must be squelched. The key element to accomplish this lies in the ability for the government to instill division and distrust among the people themselves; so much so, that the masses turn on each other to assure compliance to order to have a false sense of security. This leads to voluntary servitude, which is vital to the evil governing system, because once force is the only option for the state, chaos, revolution, or violent civil unrest will replace tyranny.

With this in mind, the plot to achieve an economic and technological reset is being pursued through lies and propaganda at every level, including the use of the military within the boundaries of the United States. This is happening globally as well, and in fact is far advanced in some areas of the world. This should be of extreme importance to Americans, because what is happening in other parts of the world will soon be on our doorstep, as the areas around the globe experiencing more extreme control measures are being used as tests to gauge when to let loose similar policies here. It is only a matter of time.

Next door in Canada, the military is openly using propaganda methods as training in order to understand how that population can be maneuvered into a position of total compliance. In Australia, where extreme gun control efforts in the past disarmed the entire citizenry, brutal controls are now in place to capture and contain the people so that any resistance can be eliminated. Harsh measures and mandates are also being ramped up again in the U.K. Compulsory vaccination legislation is also going forward in Australia, with possible long jail time and high fines for refusal to comply. Gun control and a state monopoly of arms and force is always a prerequisite to totalitarian rule. Most Americans still have the ‘legal’ ability to possess weapons, but that could change with any new legislation, or emergency executive orders due to a contrived and purposely structured threat. If the people give up their arms, they would stand defenseless in the face of a heavily armed state and military. That cannot be allowed to happen.

One of the major plots to gain control over the masses rests in the development and distribution of vaccines. Trump said recently that Pfizer Pharmaceuticals had developed and successfully tested a Covid vaccine. This was an outright lie meant to gain political favor in this time of a contentious election battle. In addition, Trump had made an announcement earlier that he had deployed the military to stand ready to distribute these poisonous vaccines across the nation. This borders on insanity, and is an attempt to frighten the herd so greatly by claiming this vaccine delivery should be a military operation. But as it stands now, this government and its military, as well as all police and ‘security’ forces, are at war against the people of the United States. In other words, the new enemy of America according to the self-claimed ruling ‘elites’ and their pawns in government are all of us lowly citizens.

While we are in the midst of the most corrupt and criminal election fraud in our history, and this includes many players from both sides, but especially on the left this time around, and the entirety of the mainstream media, the masses are ignoring what is continuing to go on concerning the takeover of this country and the world. Covid-19 seems to be on the back burner for the moment, and playing second fiddle to the election circus, but that is not the case. All the nefarious agendas concerning this fraudulent virus ‘pandemic’ are not only still in place, but advancing without pause. More lockdowns are occurring in this country and globally, and vaccine plans are in place. Pfizer has openly stated that they already have a stockpile of vaccines awaiting the go ahead from the FDA, even though no serious testing whatsoever has occurred. I have stated many times that this Covid vaccine has been available for a long time, waiting for the right moment to be released on the public. Depending on the outcome of this selection by the ruling class, the entire country could be shut down almost overnight. Plans are set to increase the tyranny, and blame it on this fake virus, and regardless of who is chosen to be the next president; there will be substantial trouble ahead.

The U.S. government’s primary enemies today are the American people, all of us, especially any that question and disobey state mandates. What is planned and what is possible in the near future is staggering. New lockdowns seem imminent at this point, and could be handed down at the national level, which would vastly increase the risk of federal and military policing and martial law. Isolation from friends and family will increase, and job loss will escalate as more lockdowns occur, causing an economic catastrophe, which will lead to a digital monetary restructuring. Travel will become even more impossible, and even local borders could close or be heavily restricted. Those that refuse the forthcoming deadly vaccination will find themselves in a virtual prison, as without a vaccine or health pass, normal life and sustaining any normal life will disappear. Surveillance that is already expansive will become so invasive as to eliminate all privacy, inside or outside the home. Contact tracing will likely become a federal system, with tens or hundreds of thousands of new government workers with one mission; to spy on and report any not acquiescing to government rules. Food shortages that are already evident in many areas would dramatically worsen, causing hunger, poverty, and sickness. Parents brave enough to protect their children by refusing toxic vaccines or quarantine could have their children removed from the home. All this could easily bring about unrest, rioting, looting, and violence as well, whether purposely designed or not, and this could in turn lead to internal warlike scenarios, especially in the cities.

This is no time to be complacent, and no time to ignore these risks. Worse times are coming regardless of this political nonsense, and increased control will be prevalent no matter the final outcome of this state selection process. Wake up people, as our lives are losing all meaning, and all the joy, emotion, and love of life are being systematically destroyed in favor of technocratic transhumanism, which can only lead to a robotic existence devoid of wonder and feeling.

Extreme evil is coming, and hell is coming with it, so cowardice in the face of this evil; refusing to take risks to remain free, guarantees a deserved slavery.

Prepare for Winter

November 14, 2020

Realism must precede optimism or the optimism will collapse as the tsunami of reality comes ashore.

It's time to prepare materially and psychologically for a winter unlike any other in our lifetimes.

Here's the view from 30,000 feet:

1. The stock market and the general zeitgeist of optimism have soared based on expectations that the real-world economy and efforts to suppress Covid would also track a V-shaped recovery.

While GDP did make a V-shaped recovery, GDP (gross domestic product) is a measure of flows and consumption, not a measure of the socio-economic "balance sheet." GDP measures the money flowing through accounts but not the "assets" of a functioning society: functional institutions and infrastructure and the well-being and security of the citizenry.

Thus GDP soars while the real-world economy and society are hollowed out by economic inequality, declining health, financial insecurity, rising prices for essentials, dysfunctional institutions and decaying infrastructure.

Simply put, GDP doesn't measure what's important; it creates destructive incentives to squander resources and borrow staggering sums to support more consumption. This systemic flaw in what we measure has long been recognized by mainstream economists such as Joseph Stiglitz. Measuring What Counts: The Global Movement for Well-Being (Joseph E. Stiglitz et al.)

So the recovery of GDP doesn't mean the real-world economy has been restored to pre-Covid settings. GDP is a deceptive metric that's masking a free-fall in our well-being, security and social cohesion.

2. Just as GDP is a deceptive measure of the economy, counting Covid fatalities is equally deceptive: a declining death count is good news, of course, but that ignores the other effects of Covid, particularly organ damage and "Long-Covid" debilitation, not just in people with pre-existing conditions and the elderly but in healthy middle-aged and even some young people.

As this article from the University of California - San Francisco (UCSF)--one of the world's top healthcare research centers--explains, this is the result of Covid being a hybrid virus. Initially it was thought to be a respiratory virus like influenza, but it is now clear that Covid infects and disrupts many other systems in the body--endothelial, digestive, the heart and other organs. We Thought It Was Just a Respiratory Virus: We were wrong.

What We Know So Far about How COVID Affects the Nervous System (scientificamerican.com)

Risk for In-Hospital Complications Associated with COVID-19 and Influenza (CDC) "Patients with COVID-19 had almost 19 times the risk for acute respiratory distress syndrome (ARDS) than did patients with influenza. The percentage of COVID-19 patients who died while hospitalized (21.0%) was more than five times that of influenza patients (3.8%), and the duration of hospitalization was almost three times longer for COVID-19 patients."

The precise pathways and mechanisms of these long-term consequences are under intense study. Initial estimates are that about 1 in 20 people who came down with Covid are suffering some long-term consequences. These consequences--for example, damage to the heart--are typically only identifiable by exams and tests: superficially, the damage is not visible.

What is known is that Long-Covid affects females more than males, it affects otherwise healthy people who were previously fit and active, and tens of thousands of people have reported long-term symptoms of extreme fatigue, brain fog, etc.

There are no treatments yet and the prognosis is cloudy. There is no clarity yet on how long these problems may last or if damage to organs is permanent.

So the percentage of people dying from complications of Covid may not be the number that most accurately reflects the disease's toll: the number of people with Long-Covid might be the more accurate reflection of the toll and the seriousness of the challenges ahead.

At 12, She's a Covid 'Long Hauler'

3. Many see herd immunity as the eventual solution to Covid. History suggests this isn't as neat and tidy as many expect. The first wave of a novel pathogen may appear to reach herd immunity, only to re-emerge a few years later with renewed contagious vigor.

While it's far too early to reach any definitive conclusions, preliminary evidence suggests natural immunity might decay within 6 months. This is supported by documented cases of re-infection, and in some cases the second infection is much worse than the initial infection. What reinfections mean for COVID-19 (The Lancet)

This evidence suggests herd immunity might not be the solution many expect.

Herd immunity is reached around 60% or higher, which suggests 200 million Americans would need to be infected to reach herd immunity.

4. The death rate for Covid is low for the entire populace, but it rises sharply for those with pre-existing conditions such as metabolic disorders (diabetes, pre-diabetes, etc.) and age (over 65).

A recent study on at-risk patients (ages 60 to 72) in 38 hospitals found about 30% had died within 60 days. Sixty-Day Outcomes Among Patients Hospitalized With COVID-19 (Annals of Internal Medicine)

The problem is these at-risk populations are not small. There are 34 million people with diabetes, and an estimated 88 million Americans are pre-diabetic. 53 million Americans are 65 or older, and roughly 7 million are 80 and over.

There is obvious overlap in these categories--people may be diabetic at age 70--but even with the overlap, these at-risk populations are roughly half the entire population (165 million people).

As this article from Nature.com explains, the infection fatality ratio (IFR) rises from near-zero for young people to 3.1% for 65-74 year olds and 11.6% for those 75 and older. The coronavirus is most deadly if you are older and male — new data reveal the risks (Nature.com)

According to this report from the American Diabetes Association, the data from early reporting indicates the death rate for those with diabetes was 7.3%.

COVID-19 in People With Diabetes: Urgently Needed Lessons From Early Reports (American Diabetes Association)

As a thought experiment, let's apply these death rates to at-risk populations at the "herd immunity" minimum of 60% of the populace:

A. 34 million diabetics X 60% = 20 million X 7% = 1.4 million deaths

B. 65-74 age group (28.6 million) X 60% = 17 million X 3.1% = 553,000 deaths

C. 75-84 group (14.2 million) + 85+ group (6.4 million) = 20.6 million X 60% = 12.4 million X 11.6% = 1.4 million deaths

This adds up to 3.3 million deaths without even counting any deaths in the populace younger than 65 or among the 88 million people with metabolic disorders.

The data suggests that 200 million infected people (60% of the U.S. population) would lead to about 3 million deaths and 10 million cases of Long-Covid.

Let's say better treatments and self-isolation will cut the deaths to 2.5 million. That would be extremely positive, but what about the Long-Covid cases? The system has yet to even start collecting comprehensive data. Thus many of the eventual consequences and costs will remain unknown.

5. Hospitalizations and treatments are rising rapidly. Hospitalizations and deaths are trending upward.

Yet experts warn that the variability may simply end with the virus resurging to high levels across the entire country. "I don't see any location in the United States that's going to be free of a major increase in cases," he said. "And I think we're just getting started."

When high case counts emerge in communities, the spillover to surrounding populations is rapid, Dr. Osterholm said. The situation, he noted, can be likened to a "coronavirus forest fire."

"A forest fire never burns evenly everywhere," he said. "But if the embers are still around, they ignite again and then that area does burn eventually. And I think that that's what we're seeing here."

"We're going to see much less evidence of regionalization of this virus over the course of the next several weeks," said Dr. Michael Osterholm, an infectious diseases expert at the University of Minnesota. "I think this is going to ultimately end up being an entire country on fire."

6. If you look at the chart of hospitalizations, the healthcare system in many locales was experiencing extreme stress at 60,000 hospitalizations, and so the rise above this level could trigger second-order effects which could cascade into a breakdown.

As this report from the CDC explains, a significant number of healthcare workers have been infected and hospitalized, and many died. COVID-19–Associated Hospitalizations Among Health Care Personnel (CDC)

Should the number of healthcare workers who contract the disease or burn out due to extended shifts and exhaustion rise beyond a certain point, the ability to provide care from everyone who is seriously ill may become severely impaired.

So there are two limiting factors on care as the number of hospitalizations soars: the number of beds available in Covid-secure wards and the number of healthcare workers available to provide care.

If either of these limits are reached, death rates may rise as patients are unable to get all the care they would have received had cases and hospitalizations not exceeded the capacity of the system.

7. There are lag times in effects and reporting:

--3 weeks: infection-to-death

--4 weeks: deaths reporting

--4 weeks: propagation to older age groups

--8 weeks: infection, partial recovery/discharged from ICU, death

Note the almost exponential rise in cases being reported. We can anticipate a surge in hospitalizations, deaths and spread to older populations in the weeks and months ahead.

8. Vaccines: I provided an analysis and numerous links on the many uncertainties surrounding vaccines in Everything You Don't Want to Know About Covid Vaccines (Because You Can't Be Bullish Anymore) (November 11, 2020)

Covid-19 Vaccine Protocols Reveal That Trials Are Designed To Succeed (Forbes.com) by William A. Haseltine

9. The virus remains highly contagious. Wedding and Birthday Party Infect 56, Leaving Nearly 300 in Quarantine (New York Times)

The projections presented here are basic math, yet few seem to have done the simple math, perhaps because the results are sobering and don't fit the desired "optimism."

Realism must precede optimism or the optimism will collapse as the tsunami of reality comes ashore.

No one knows the future, but current trends suggest all the euphoric expectations of a fast, painless recovery were tragically misplaced.

Here is the chart I prepared a week after Covid-19 hit the news in late January. Reality has been tracking my first-out-of-the-gate projection with remarkable coherence.


MathisderMalersaid:November 15, 2020 at 11:49 pm

Part of this whole psyop is of course to make people think that if they are against tyranny, they have to join with Alex Jones, Trump and the MAGA people. In that sense, it is like Occupy Wall Street, where they made you think that if you were against the tyranny of Wall Street, you had join these “dirty hippies” on the street. They want to be sure you DON’T join the revolution, so they make sure the revolution is led by people you don’t like. A revolution requires some strange bedfellows, and I am not saying it doesn’t, but these people like Alex Jones aren’t bedfellows, they are bedbugs. They are there to make sure the revolution fails. I repeat that it is important that they are making you think that “liberals” aren’t welcome in the revolution. They are making you think this whole thing is coming out of the Republican Party, which is now being sold as the party of the working man. Really incredible, but it is true. You are supposed to believe that conservatives are driving the revolution. It is a massive mindfk. No one who lived through the Reagan and Bush Presidencies would believe it, but that is the current story. So as usual, the plan is to divide us down party lines, with both parties being controlled opposition. Sensible people don’t want to be on either side, Red or Blue, so by tying to the Revolution to Red, it will be stalled and coopted. They actually have the Revolutionaries fighting to maintain Trump in office! How perverse is that? Revolutionaries fighting for the sanctity of the Republican Party. You have to laugh, it is so absurd.

das8777said:November 16, 2020 at 12:33 am

Carroll Quigley in his book, Tragedy and Hope, states there are seven-stages in the rise of civilizations: mixture, gestation, age of expansion, age of conflict, universal empire, decline, and then invasion. During An Age of Conflict, the powers-that-be, historically, will decide on three outcomes or plans of action. 1) Go further into draconian power-plays, 2) compromise with the public/masses, or 3) allow a new paradigm shift with other political players.

I think what we’re seeing here is a paradigm shift and fighting among the family-elites. Trump represents the new guard of Israel, Russia, and Saudi Arabia. The old guard is made up of China, Iran, and Germany.

Germany is tapped out as credit issuer, so it needs a further dependence of global dominance, but it needs Russia to supply energy demands, but still wants Russia subservient to Germany’s economical paradigm. Trump is playing the populists movements, and this is becoming widespread in Central and Eastern Europe, with a rise of more conservative values. The UK, which was always the lead credit supplier going back some four centuries, created the Brexit movement as a stop-gap to see where the next paradigm-shift lands, and, as usual, will wait to see how it all plays out. The family-elites running China’s economic engine probably went to far in expanding, cutting into markets of older Phoenician bloodlines, and, as a result, pissed off some of the main players of the Phoenician’s backing a strong Israel branch running global-economics through the United States. The Phoenician/China faction is becoming evermore draconian in assaulting concepts of personal liberty, because they have no other choice. It’s their way or the highway. Whereas, the Israeli group is playing to and placating the populist movements. Although, it may all be manufactured, as you say, but, it is interesting that Oswald Spengler in the Decline of Civilizations, stated that the next rise of civilization will be in Eastern Europe (take a look at what’s going on in Russia, Hungry, Poland, and even Austria). As for the propaganda machine known as MSM, they’ve been losing viewership and laying off employees, so, perhaps, a new form of controlling information is taking place, as we go from mass communication to smaller network communication societies. If Trump is not decided to be the winner, he then builds a media empire that effectively makes the China/Phoenician group constantly exposed, and unable to put the genie back in the bottle. Then, as the China/Phoenician group loses economically on the global markets, the Israel/Phoenician groups begins buying up more corporations for pennies on the dollar. The honeypot has been set, and greed and avarice does the rest. Meanwhile, the authenticity of being liberal or conservative is conflated, and the populace play along thinking they’re working toward greater individual freedom.


I apologize, but I wasn’t clear: the factions fighting are the China/Phoenician, i.e. Biden’s camp, and the Israeli/Phoenician, which is Trump’s camp.

COMPOSITE OF ARTICLES 11-16

Jordan Peterson's Most Important Rule for Life

Jordan Peterson is back, and the primary lesson from his book remains as important as ever.

Nearly two years ago, friends purchased me a copy of Jordan Peterson’s best-selling book 12 Rules for Life.

I started the book shortly after receiving it, but somewhere along the way I got sidetracked and didn’t finish. (This never used to happen to me, but raising three kids has altered my reading habits.)

With Peterson’s recent return to the public scene, I decided to return to the work. I’m currently reading Rule #12 (“Pet a Cat When You Encounter One on the Street”), and plan to review the work eventually.

But before tackling the entire book, it seemed appropriate to share the most important rule in Peterson’s seminal work, which has sold more than 3 million copies worldwide.

Take responsibility for your life.

That’s it. It sounds simple, trite even. It’s something you’d expect your father or grandmother to tell you after you screwed up or got fired.

Nevertheless, it’s a message sorely needed right now. Norman Doidge, who wrote the foreword to 12 Rules, agreed that is the primary lesson from Peterson’s book.

“...the foremost rule is that you must take responsibility for your own life. Period,” writes Doidge, a psychiatrist, author, and friend of Peterson. (emphasis added)

To be clear, “take responsibility” is not actually one of Peterson’s 12 rules. Still, Doidge’s assessment is correct and should come as little surprise.

Personal responsibility over one’s life is an idea embedded throughout the rules Peterson offers throughout his book as an antidote to the chaos many of us feel today. (It’s also a theme of his lectures and interviews.) When Peterson says stand up straight, make good friends, set your own house in order first, tell the truth, make your bed, be precise in speech, etc., he’s not really concerned about how clean your room is. He is instructing readers on how they can take control of their own lives. He’s reminding them of their power. Their agency.

The question is, why does this lesson suddenly feel so important? After all, Peterson’s message is not exactly new. In many ways, his teachings channel some of the ancient Stoics, who millennia ago taught that the path to a peaceful and happy life was to master the one thing humans can truly control: themselves.

“Where is the good? In our choices,” the Stoic philosopher Epictetus once observed. “Where is the evil? In our choices.”

The message of the Stoics was to not subject your own feelings, your own happiness, to external factors. After all, we often have little control over events and circumstances and people. The path to harmony and happiness is learning to control how we, as individuals, respond to these things.

The ideas of self-empowerment, self-control, and individual initiative are hardly unique to the Stoics, of course. Other ancient philosophies explored these concepts to varying degrees, and the themes are interwoven in the American idea, and found in classic works, such as Benjamin Franklin’s Poor Richard's Almanack and Ralph Waldo Emerson’s Self-Reliance.

d12e9117613a1599144490-donate-thankyou-landscape.png

Join us in preserving the principles of economic freedom and individual liberty for the rising generation

Support FEE's Mission

The problem, as Peterson sees it, is Americans are no longer receiving these lessons. In a 2018 interview with British GQ, Peterson was asked why people were so “hungry” for his message.

“They are hungry for a discussion of the relationship of responsibility and meaning,” Peterson responded. “We haven’t had that discussion in our culture for 50 years.”

This is an incredible statement. For most of human history, thinkers have explored this issue—how our individual choices intersected with living a life of meaning—perhaps above all others. It was central to the philosophies of thinkers from Plato and Aristotle to Immanuel Kant and Nietzsche.

But Peterson says we no longer grapple with these questions. Postmodern philosophy has taken us in new directions.

“We’ve concentrated on rights and privileges and freedom and impulsive pleasure,” Peterson says. “Those are all useful in their place, but they’re shallow, and that’s not good. Because if people are moored shallowly, then storms wreck them. And storms come along.”

Leaning into responsibility is how humans learn to bear storms, which are inevitable. As many know, Peterson encountered his own storm when his wife Tammy was diagnosed with terminal cancer in April 2019, and he struggled with a dependency on the drug benzodiazepine.

Peterson survived his storm because his life was moored in responsibility, which offered meaning and strength.

Sadly, many people today are unmoored.

When Peterson says we haven’t had a discussion on responsibility and meaning in our culture “for 50 years,” he’s alluding to a cultural shift that has taken place.

It’s not just that we don’t teach people how to take responsibility for their own life; it’s that in many ways we actively discourage them from doing so. Woke culture, safe spaces, and victimhood—each is a manifestation of a culture that has replaced individual responsibility with collectivist notions of injustice. People are openly hostile to Peterson's message of owning your life.

This is not to say that injustice is not real. It is, and it always will be. The problem is that in our quest of ridding the world of injustice, we’ve forgotten that we must first own and fix ourselves.

Moreover, Peterson’s message is not to ignore injustice. His message is to take responsibility for your life despite the presence of injustice, which will always exist. (Peterson has pointed out, for example, that studies show a parolee's fate hinges to a troubling degree on whether the hearing judge ruled before or after her lunch. Apparently, hungry judges are much less likely to be forgiving).

This is how one becomes a ship that can weather storms—not by placing your power in things beyond your control, but by taking responsibility over the things you can.

The very fact that people can treat Peterson’s message as foreign, strange, and worthy of their hostility is evidence of how necessary it is.

We should be thankful Jordan Peterson is back to deliver it.

‘It’s Just the Flu, It’s All BS’ – Russia’s Top Official COVID Doctor Admits in Bombshell Invu

Mon 11:06 am +00:00, 16 Nov 2020

“It’s all exaggerated. It’s an acute respiratory disease (i.e. the flu) with minimal mortality. Why has the whole world been destroyed? That I don’t know.”

This post first appeared on Russia Insider

Alexander Myasnikov was appointed in April to his new role of informing Russians about coronavirus treatment and prevention methods and to battle “fake news” about Covid-19

it is difficult to overstate how important this is. This man is the equivalent of Fauci in the US, or perhaps Dr. Deborah Birx. The 1.5 hour long interview below is only in Russian, but if you can understand it, it is well worth watching, because a lot of important information is covered.

The interviewer is Ksenia Sobchak, who is very liberal – think of her as like a Russian Rachel Maddow. Like liberals in the West, she very much wants to believe the COVID situation is much worse than it really is. Myasnikov explains to her in detail why it is in fact very difficult to assign ’cause of death’ in most cases, because there are usually several, in addition to a lot of other things.

It is a great interview, in which the good doctor finally loses his patience and tells her its not nearly as dangerous as people think, and that the whole world has over-reacted. He also insists that the death numbers in the West are way over-counted.

He’s right.

This interview is also a great example of the high level of journalism in Russia – this is much more genuine, open, exciting, and authentic than most of what is on mainstream media in the West. Just watch a few seconds of the intro, and you will get the idea.

From the Moscow Times:

Russia’s head of coronavirus information has suggested that global anxiety over the pandemic is misplaced, his latest controversial comment after saying that the infection would kill as many people as it needs to.

Doctor and television presenter Alexander Myasnikov was appointed in April to his new role of informing Russians about coronavirus treatment and prevention methods and to battle “fake news” about Covid-19. After calling the country’s reported low death rate a “Russian miracle,” Myasnikov said last week that “those meant to die will die” from it.

In an interview that aired Wednesday, Myasnikov gestured for the cameras to stop running and said candidly: “It’s all bullsh*t.”

“It’s all exaggerated. It’s an acute respiratory disease with minimal mortality,” he told television personality Ksenia Sobchak in the interview for her YouTube project.

“Why has the whole world been destroyed? That I don’t know,” Myasnikov said, adding that he’s more concerned about a second wave that he claimed “we’re unprepared for.”

https://russia-insider.com/en/its-just-flu-its-all-bs-russias-top-official-covid-doctor-admits-bombshell-invu/ri30462

Elite Transnational Fascism – Covid & The Gameplan

Mon 10:19 am +00:00, 16 Nov 2020

posted by Weaver

ELITE TRANSNATIONAL FASCISM

WINTER OAK

We are reposting here this important article by Ullrich Mies from the German-language Rubikon site, in the form of a “raw” translation via Alison Blunt and deepl.com

********

Since March 2020, the form of rule that has been systematically unfolding since the fall of the Berlin Wall in 1989/1990 has been fully in evidence: A transnationally operating oligarchic caste has taken over rule in the Western “democracies”.

The mass base of “traditional” fascism was the enthusiastic petty bourgeoisie, incited by propaganda (1). The leader (state) promised the masses salvation from all evils. The leader carried the masses, the masses carried the leader (state) and the latter led them into war and ruin in the interest of (monopoly) capital.

In the course of recent decades, a transnational, well-connected caste has emerged, which no longer conducts its wars only outwardly, but has recognized civil societies as a whole as a threat to its power. Since March 2020, the centers of power have expanded their wars inwards in the name of the corona infection regime.

By transnational “elite” fascism I mean an alliance of transnational capitalist class, transnational power elite (2) with the transnational digital, military, intelligence, science and media complex and the governments as their executive committees. I refer to this conglomerate as the parasites of civil societies, which serve as their “host” bodies.

Their new means of rule is a health dictatorship based on infection regimes that can be activated at any time. Today Covid-19, tomorrow rhinoviruses, the day after tomorrow perhaps malaria or a “biological warfare” attack.

A propagandistic masterpiece unprecedented in the history of mankind

The never-ending “war on terror” has been extended by the “war on infection” since March 2020. This is directed against humanity as a whole.

The “great concern” of the centres of power for “public health” is a propagandistic masterpiece unprecedented in the history of mankind. It is a PSYOP prepared for years, a psychological warfare against civil societies.

After decades of mistakes by the ruling cliques, the legitimacy of Western politics was at zero by the end of 2019. And those who have ruined the planet, humanity, coexistence, inner and outer peace and all positive values of human history, should now be the great saviours of humanity?

How ahistorical, unsuspecting, naive and brainwashed by the media does one have to be to believe that the drivers of globalized catastrophe capitalism and the perpetrators of the disaster that has been wreaked have great concern for the health of the people?

Emergency state as permanent state

The “mass base” of the centers of power has long since ceased to be the followers of convinced people. Their new followers are the masses of manipulated, lied to and terrorized people in a state of fear and panic. The mass media stupefaction secures the fear-based entourage.

Jeffrey A. Tucker from the American Institute for Economic Research writes about this in his article “When will the Madness end?”:

““I’m a practicing psychiatrist who specializes in anxiety disorders, paranoid delusions, and irrational fear. I’ve been treating this in individuals as a specialist. It’s hard enough to contain these problems in normal times.

“What’s happening now is a spread of this serious medical condition to the whole population. It can happen with anything, but here we see a primal fear of disease turning into mass panic. It seems almost deliberate. It is tragic. Once this starts, it could take years to repair the psychological damage”. (3)

From now on, the state of emergency can be declared a permanent state at any time. In addition, the mask compulsion is intended to rehearse us for obedience and subservience, to ensure the “cohesion” of the mask wearers and their submission to supposed authorities, as well as to outlaw the “mask enemies” as “non-solidarity endangerers”.

Currently, the perpetrators are terrorizing our children in the schools by forcing them to wear masks. This is where the new subject is bred.

The means of domination of the centers of power is the “infection” state of emergency with the exclusion of civil rights. The Merkel clique and their entourage have cold-cleaned the Basic Law. From now on, the state of emergency can be declared a permanent state at any time.

Even “democracy” in its deficient form of party democracy has been suspended by the Covid state of emergency, and the separation of powers has largely collapsed.

Bill Gates and his scientific and political collaborators do not want us to ever return to the pre-Covid 19 state (4).

This is the end of the democracy project and the final takeover by the plutocracy, a silent coup d’état

Democracy as we knew it belongs to the past. Bernd Hamm had already written about this in 2017:

“The neoliberal ideology has helped to reduce state regulations & accumulate wealth at 1 percent. The rich are able to influence a considerable part of state legislation in their favour.

“They and their wealth are advised and protected in their services by hosts of parliamentarians, managers, accountants, lawyers, tax advisors, think tanks, radio stations, film studios, publishers, media, researchers, hacks, lobbyists, bodyguards and other lackeys.

“Private property is the golden calf of capitalism and unregulated capitalism is the bible of the ruling class. They can even mobilize police and military on their behalf. The nation state and its government remain important institutions, but above all, governments must keep the masses under control. This is the end of the democracy project and the final takeover by the plutocracy, a silent coup d’état” (5).

Traditional fascism combined mass support and propaganda with hard-hitting (street) terror and hall battles against its enemies.

By contrast, transnational “elite” fascism is much more subtle and intelligent. As the German variant of transnational “elite” fascism, the Merkel clique, the neoliberal party unit and media front, as well as the third-party prostituted science (6), all try to push through their position and maintain their power by all means of propaganda, censorship, the dismantling of any opposition and the suppression of “deviators”.

Reset of World Economy

The centers of power intend to enforce several lockdowns to achieve their goals. Ultimately, they aim to reset the world economy (7).

They want to “rebuild” the “old” globalized disaster capitalism that brought the planet to the brink of collapse. But the fundamental goal is to maintain the capitalist system under the newly created conditions of the 4th Industrial Revolution after the Great Reset.

The states are to be fully subjected to the control of the international financial industry.

Before the Corona crisis, Germany had national debts of around 2 trillion euros. It took Germany 75 years to accumulate these. It took the Merkel team 3 months to double this national debt.

The centres of power are striving to privatize the remaining state property under the control of the international financial industry through the total indebtedness of the states

Deutsche Bank wrote about the consequences of the Corona crisis on April 24, 2020: “According to our calculations, the German state can fall back on a staggering sum of up to 1.9 trillion euros, well over 50 percent of German GDP, through the anti-crisis packages that have been launched […]” (8).

Deutsche Welle wrote on 24 June 2020: “At least $15 trillion […] has already been earmarked by governments and central banks to fight the corona pandemic and its consequences. Including the debts… of companies and banks, the IIF (Institute of International Finance), the banking lobby association, comes to an unimaginable 250 trillion dollars” (9).

In June 2020, the World Bank offered Belarus a loan of 940 million US dollars on condition that the country agreed to a lockdown, i.e. the ruination of its economy (10). (ER: we know that PM Alexander Lukashenko blew the whistle on this. See World Bank/IMF Exposed: COVID Aid Conditional On Imposing Extreme Lockdowns, Curfews)

The centres of power are striving to privatize the remaining state property under the control of the international financial industry through the total indebtedness of the states.

The total indebtedness of states is a means of enslaving humanity

Broke companies, which have been driven to the brink of insolvency by the Corona crisis, are then taken by the radical pro-market governments under state control in order to force the taxpayer to bear the cost of their restructuring. The total indebtedness of states is a means of enslaving humanity (11).

In Europe, the EU is the decisive control center for the de-democratization of nation states. The ruling economic and political cliques do everything they can to maintain the faltering EU as their power project, to completely undermine the democratic institutions of the nation states and to further disempower the parliaments.

The 27 EU states have just agreed on a budget and financial package in the historic order of 1.8 trillion euros.

It is already certain that the money will primarily end up in banks to refinance old debts, as was the case with the earlier aid to Greece (12).

Democracy-free commissions, directorates, senates, stakeholder agreements and backroom committees of all kinds secure the totalitarian rule of the transnational oligarch caste. The nation state serves them solely as a surveillance and repressive state to keep the populations under control.

Population Reduction

Global population reduction is an integral part of the great global economic reset. For the 4th industrial revolution, billions of people are “superfluous” (13).

The “cleansing” of the world population will take place through the creeping destruction of small and medium- sized businesses and the worldwide supply chains with hundreds of millions of employees.

The part of the small and middle class that can be “exploited” by the international investment strategists is being squeezed out of self-employment and into the dependent low-wage sector; others are being subjected to digital and platform corporations and their exploitation strategies; and large parts are going under, as the domination strategists intended.

According to the International Labor Organization, the first lockdown has already left 1.6 billion people in the so-called informal sector unemployed, i.e. people without regular employment contracts.

The question is: “How many hundreds of millions of people will lose their lives through the economic destruction of existence?

All that matters is new gigantic business models for Big Pharma, Big Money and Big Government, which are staged with all means of propaganda and repression

The centres of power tread smilingly over millions of corpses. They have sufficiently proven this through their wars alone after 1989. The First and Second World Wars claimed more than 100 million lives.

If “only” 10 percent of the 1.6 billion died as a result of the targeted economic destruction of existence, this would mean 160 million people (14). But there will certainly be more!

Whether the centers of power and their figurehead Bill Gates also aim to reduce the world population through vaccination regimes is open to speculation (15).

Bill and Melinda Gates act as the great saviours of humanity through vaccination regimes (16). They are definitely not saviours of humanity! All that matters is new gigantic business models for Big Pharma, Big Money and Big Government, which are staged with all means of propaganda and repression.

“For Bill Gates, vaccines are a ‘strategic philanthropy’ that feeds his many vaccine businesses and gives him dictatorial control over global health policy” (17).

The 4th Industrial Revolution

Goals of the 4th industrial revolution (18) are:

the abolition of all democracy

a new geopolitical order

5G (19) and the associated satellite technology. 5G is primarily a technology for the military to wage wars on completely new bases. 5G is installed and the consequences for man and nature are completely ignored

the Internet of Things (20), it is about technologies of a global infrastructure of information societies

a cashless world (21)

the establishment of a cold social life of social distance and total biometric control

a compulsory vaccination regime using genetic engineering and nanotechnology, with the pharmaceutical companies being absolved of all liability

the expansion of artificial intelligence in conjunction with post- and trans-humanism, i.e. the fusion of man and machine (22)

the construction of “smart cities” (23)

The transnational “elite” fascists are seeking a New World Order of dictatorial global governance

In summary, the transnational “elite” fascists are seeking a New World Order of dictatorial global governance.

After the great reset (24), the remaining world population will supposedly live in a new world. The centres of power are doing their utmost to ensure that, after the transition to the 4th Industrial Revolution, their New World Order will be irreversible.

Requirements for a new beginning…

Since the centers of power are rebuilding the world unrestrainedly, the resistance is allowed to think about how humanity, in particular in the western facade democracies, could find its way out of the current morass. Here are some thoughts on this:

Dissolution of political parties in their present form and function

Resolution of corrupting lobby complexes

Dissolution of the secret services, at least their massive reduction

Reduction of the military to national defense

Abolition of politician immunity

Confiscation of party assets or political assets in the event of proven constitutional and legal violations and damage to the general public

Responsibility through genuine assumption of responsibility, i.e. political liability – Penalty reinforcement in case of breaking oaths of office

Convening Constituent Assemblies

Strengthening direct democracy

Completely new conception of the media, i.e. placing them under popular democratic control.

A new generation of politicians must have proven themselves “in life”, must comply with ethical-moral principles, constitutional and legal compliance and must be accountable for this before assuming public office.

This would be an essential start.

Don't Blame Covid: The Economy is Imploding from Over-Capacity and Corrupt Cartels

November 16, 2020

Now that the bubble has burst, the hope is that removing the pin will magically restore the burst bubble. Sorry, it doesn't work that way.

Here's the fantasy: if we stop the shutdowns, the economy will naturally bounce back to its oh-so wunnerful perfection of Q3 2019. This is a double-dose of magical thinking and denial. The U.S. economy was unraveling in 2019 from 11 long years of Fed-induced over-capacity in almost everything (except integrity, competition, transparency and social cohesion) and the bone-crushing burden of corrupt, greedy cartels that have the nation by the throat.

The reality nobody dares mention is that thanks to 20 years of the Federal Reserve's easy money, there's rampant over-capacity everywhere you look: there's too many cafes, bistros, restaurants, fast-food outlets, hotels, resorts, AirBnBs, unprofitable Tech Unicorns, airline flights, Tech startups, office towers, retail space, malls, absurdly overpriced apartments for rent, storage facilities, delivery services, office sublets, colleges, attorneys, unemployed workers with multiple credentials--the list of too much, too many is endless.

Thanks to the Fed, the most profitable venture was borrowing to increase capacity, then borrow some more to extract the phantom value created by the greater capacity. Nobody cared if the office tower remained mostly empty; the money was made in building it and extracting its "value" via debt, not operating a legitimate enterprise.

This Fed-created house of cards was never sustainable, or healthy, as all the incentives to add capacity were perverse. The illusion that every mall, office tower, retail space, college, apartment building, etc. would be filled was only plausible as long as consumers and zombie corporations were borrowing and spending more than they earned.

That was never sustainable, but rather than look at the systemic set-up of an insanely predatory, fragile debt bubble resting precariously on over-capacity, the status quo is blaming Covid and lockdowns. The problem isn't the pin, it's the bubble that was begging to be popped by something, anything.

Recall that bubbles pop on their own, even without a pin. Japan's debt / stock / real estate bubble popped in 1989 without a pin; prices just stopped going up and then started falling, all by themselves.

The other reality no one dares mention is the stranglehold of corrupt cartels that have long outlived their purpose, and now exist solely to enrich insiders and lenders and the wealthy few who own the student loan debt, mortgages, etc.

The entire higher-education cartel was an unaffordable, unsustainable racket eight years ago when I wrote my book The Nearly Free University. Now the racket is finally unraveling, and the insane over-capacity, insanely high costs and lack of value in the credentials are coming home to roost.

The healthcare system is another example of a sprawling system of cartels that's long overdue for a reckoning / unraveling. The fortunes being minted bought more than enough political power to keep the corrupt, predatory machine well-greased with federal money, but that doesn't mean the system is actually providing healthcare effectively or efficiently or in a sustainable fashion.

Now we have multiple Big Tech monopolies bleeding the nation dry, and Big Tech is rushing to flood Washington D.C. with lobbyists and campaign contributions so nobody messes with its parasitic, destructive layers of monopoly.

The entire American economy was a gigantic bubble of corrupt Fed-funded skims, scams, rackets, monopolies and cartels, and it was finally bursting in 2019. The Fed, oh-so protective of its ever-greater and more destructive bubbles, rushed to mask the rot by inflating the greatest bubble of all time: Forget GOAT, Look at GBOAT: The Greatest Bubble Of All Time (November 6, 2020).

Now that the bubble has burst, the hope is that removing the pin will magically restore the burst bubble. Sorry, it doesn't work that way. The bubble has already burst and cannot be magically made whole and re-inflated.

It was never sustainable or healthy, and its collapse was inevitable. The way forward is obvious: stop the Fed from blowing ever-larger bubbles and eliminate cartels and monopolies. But that will require ending the absurd farce of pay-to-play "democracy" that enables the debt / asset bubbles and cartels / monopolies

WEDNESDAY, NOVEMBER 11, 2020

“Watch this!” https://cluborlov.blogspot.com/2020/11/watch-this.html#more

There are times in my career as a collapse observer and systematizer when my running commentary can quite reasonably be pared down to just two words: “Watch this!” The current severe stage of the financial and economic collapse sequence that was initiated in 2008, which is being artificially masked (no pun intended) by the fake Covid “pandemic,” and now a hung and fraudulent US election on top of it is just such an occasion: why not just sit back and watch the world burn? But I happen to be in a particularly good and sprightly mood today, and when I get that way few things can hold me back from holding forth and bloviating prophetically.

Let’s start with a quick jaunt down memory lane. I first realized that the USA was going to follow the general trajectory of the USSR back in 1995. I also immediately realized that the USSR was rather well prepared for collapse whereas the USA was about to be blindsided by it, and so, as a public service, I thought I should warn people. “And a fat lot of good that did!” some of you might immediately exclaim. But you would be wrong: lots of people have written to me to say how much better adjusted they are psychologically now that they have heard and accepted my message, for now they are ready to accept collapse with equanimity and poise. This is sure to make their company less tedious moving forward.

And so I had my “Eureka!” moment in 1995, and a decade later, in 2005, I went public with my observations. I got a surprisingly sympathetic response from some particularly enlightened people (even if they said so themselves). And now, a quarter of a century after my initial insight, as the US enters national bankruptcy and institutional collapse, the whole world is being treated to an end-of-empire spectacular election extravaganza starring none other than the consummate showman and impresario extraordinaire Donald Trump. He used to run beauty pageants, while this one is more of an ugliness pageant, but then beauty is rare and always fades while ugliness is commonplace and usually just gets uglier, making it a much safer bet. And so let’s accept it as a parting present to the world from a vanishing nation that gave us horror flicks, reality television and three-ring circuses with sideshow freaks.

Within the sweeping panoramic tableau of the 2020 election, Trump (our hero) appears bathed in a golden sunset glow of nostalgia for lost American greatness which he forever promises to rekindle. Rest assured, Trump or no Trump, America will never be great again. But Trump’s magic halo extends out from his resplendent orange cranial plumage and enfolds all those who pine for the lost Pax Americana and fear and loathe what America is fast becoming—which is, to put it bluntly, a holding tank for degenerates of every stripe presided over by a freak show. They pine for a time when men were manly and women womanly, when secretaries were flattered when their bosses took time away from their busy schedules to rub up against them, and when everyone was either a WASP, or worked hard on trying to look and act like one, or kept to their assigned station in life and knew better than to get too uppity. They want to believe that the ethnic melting pot can still produce noble alloys, preferably Corinthian bronze, and certainly not clinker or slag.

Arrayed against our fearless orange-hued leader, who at 74 is no spring chicken himself, is a ghoulish gaggle of geriatric gerontocrats. There is Joe Biden, 77, whose brain ran away and joined a circus some years ago but who imagines himself to be president-elect, or senator, or vice-president, or something. Having spent eight years lurking in the shadows as Obama’s VP, Biden is as fit to lead as a pig is kosher after rubbing its side against a corner of a synagogue. To assist Biden in his dodderings there is his party-appointed nanny, Kamala Harris, a mere slip of a girl at 56.

Also haunting the balcony of the American mausoleum is Nancy Pelosi, 80, who still runs the House of Representatives even though proper employment for her at this point would be up on a pole keeping the birds off the corn. There is also Bernie Sanders, 79, a sad pagliaccio whose permanent role in the political Commedia dell’Arte that the Democratic Party stages every four years is to simulate democracy by cheerleading crowds of young imbeciles in Act I, to feign death after falling off his pogo stick in Act II, and to stagger to his feet, wave and smile for the curtain call.

Last but not least, there is the horrid harpy Hillary Clinton, who is relatively young at 73 but whose putrid smell and cadaverous, ghastly visage are not longer fit for public display except in most delicately contrived circumstances. Hidden even further backstage is the suppurating cadaver of George Soros who, at 90, is still pulling the strings and wreaking havoc in the US and around the world. (His minions had recently spread color revolution to Armenia, in turn causing it to “elect” Pashinyan, a choice imbecile and a traitor, who then lost a big chunk of Armenian territory to Azerbaijan.) I could mention quite a few other financial corpses and oligarchic cadavers, but will refrain, to avoid giving you nightmares. Nobody lives forever, not even Henry Kissinger, 97, and so all we have to do is wait.

In healthy societies, older leaders age out and make room for younger leaders who take over for them after a lengthy period of study and apprenticeship. In sick societies, older leaders cling to power with no one competent there to replace them and once they die are replaced by traitors and criminals. The USSR and the USA are two such examples. The late Soviet serial gerontocracy of Brezhnev, Andropov and Chernenko, who for a time haunted the balcony of the Lenin mausoleum and, once dispatched to the netherworld, were swiftly replaced by the traitorous duo of blabbermouth Mikhail Gorbachëv and Drunk President Boris Yeltsin, was a tragedy for Russia. The resulting die-off was of the same order of magnitude as the losses incurred during World War II. In accordance with the worn-out cliché about history repeating, the current American gerontocracy is more of a farce than a tragedy, but its results are likely to be no less lethal for the population.

To complete this ghastly tableau, in the ongoing US presidential election, an almost-dead candidate and his charming assistant have been voted for by an army of the undead: voters that have mailed in their ballots in spite of being deceased. I have spot-checked a bit of the incriminating evidence myself, and I am pretty sure that there were over 11,000 such voters in a single Michigan county alone. But this is by no means a local scam: among many other vote-counting shenanigans, it appears that there was a nationwide effort to order mail-in ballots for dead people, fill them out for Biden, and mail them in. You might say that this is a human rights issue: why deprive dead people of their right to vote? Isn’t it about time to stop discriminating against the dead? Perhaps LGBTQ should be amended to LGBTQD for “Dead.” But why stop there? Why not also add a “U” for the unborn and stop this unpardonable discrimination against abortions?

In any case, dead voters for Biden turn out to be just the tip of an entire iceberg of election fraud. There are also the over 1.8 million nonexistent yet registered voters discovered by Judicial Watch back in September. Add to that the faulty voting system, creepily named “Dominion,” which miscounted votes to favor Biden. Add to that the undeservedly kid-gloved and fawning press coverage afforded to Biden and the US mass media’s overwhelmingly hostile attitude toward Trump. Add to that the fraudulent poll data which, just as prior to the 2016 election, was contrived to make a fraudulent Biden victory seem plausible. Add to that the amply funded organizations such as BLM and Antifa (in which the “Anti-” prefix is gratuitous, this organization in fact being very much “Fa…”) which have been ordered to protest, loot and riot in many major US cities, moving their mercenaries from location to location, where they then recruit useful idiots among the locals. What this adds up to is a vast, brazen, carelessly self-incriminating conspiracy to overthrow a sitting president through election fraud.

If you believe even for a moment that I am scandalized, disgusted and outraged by this trampling of the sacred principles of democracy, then pardon me while I shake my head sardonically while quietly chuckling to myself. No, I am not the least bit upset. In fact, this development fills me with optimism for the future. I believe that this ghastly institutional failure is a wonderful development that offers great hope to the rest of the world, and perhaps even to the US itself, although the political environment in the US appears to be rather hopeless irrespective of how horribly or wonderfully its ridiculous electoral system can be made to function.

In any case, it would be futile to try to give the US some semblance of a democratic election system. It would be like trying to clean up a beach by picking up empty beer cans around a beached whale. The presidency, after four years of ham-handed efforts to unseat a president using false evidence, is a failed institution. Congress, which now nonchalantly overspends federal revenue by a factor of three, is a fiscal zombie. The Federal Reserve, which is now a pure pyramid scheme, is a financial zombie. And then there is the rest of the ridiculously bloated US economy, which is waiting for a stiff gust of wind to cause ephemeral wealth to flood out of stocks and bonds and into cash, much of it evaporating in the process and the rest causing a tsunami of consumer price inflation.

In the course of this spectacle, the false image of the US as a shining city on a hill, a beacon for huddled masses yearning to breathe free and a beneficent global policeman safeguarding “universal human rights,” enforcing “universal human values” and spreading “freedom and democracy” around the world is being stomped into the dirt, having excrement poured all over it, and being stomped into the dirt some more. As the curtain descends on this final act of Pax Americana, the image of the orange enfant terrible and the senile puppet with his child-nurse in tow playing on the teeter-totter of electoral dysfunction on the playground of second childhood will forever remain etched into the retinas of the whole world. The whole world will then be able to move on and look for worthier role models and for less corrupt policemen. And that’s progress!

The collapse of the USA will make the collapse of the USSR look like a stroll through a leafy park and a boat ride on a placid pond. I’ve been saying this for 15 years now. My message is still there, for all those who wish to understand what’s been happening and to keep their sanity.

Electile Dysfunction

Taki

November 14, 2020

Electile Dysfunction

NEW YORK—Election-night parties are usually dreadful affairs, with the idiot box blaring and hysterical listeners screaming out the latest info. American TV pundits are smug trained seals with too much makeup and blow-dry, and they all sound the same with their rehearsed stentorian voices. Brian Williams, or the hero of Iraq as I call him after he got caught lying about a missile attack on the chopper he was riding—he was safely on the ground and trembling—sounded somber announcing that South Dakota had been called for The Donald. These so-called anchors no longer even pretend to be objective, and they had long faces when the predicted Biden landslide was gone with the dawn.

I too had predicted a Biden landslide, and was also wrong about a more important subject than the election—my dinner party. I had written that I would be the only pro-Trump diner, but it turned out we were six for the president and barely two for the man who lives in a basement and forgets his name at times. My guest of honor, Prince Pavlos, is required to be apolitical, although I can guess where his sympathies lie. Arki Busson is also apolitical, so I spent dinner asking him about Hollywood beauties he has known; but Arki is a sphinx when it comes to conquests, like the gent that he is. Bartle and Claudia Bull are a beautiful couple straight out of F. Scott Fitzgerald, and they didn’t mince their words. Bartle is a writer, filmmaker, and adventurer, and is often teased by us that he’s a top CIA operative. (He goes to places like Fallujah in Iraq for holidays, hence the suspicion.) My buddy Michael Mailer, needless to say, is to the left of Felix Dzerzhinsky, so no guessing was required as to whom he was rooting for. Two beautiful young women, Enga and Emilie, were too polite to express their choice, which suited me just fine.

“I actually believe that no foreign adversary of Uncle Sam’s has ever received such abuse as The Donald has.”

Exit polls showed that Trump won 18 percent of black men, 36 percent of Latino men, and 58 percent of white men. The last Republican to get as many black votes was when the man who lives in a basement could actually remember his name, back in the early ’50s. The media hysteria against Trump reached its apotheosis as the vote neared. I actually believe that no foreign adversary of Uncle Sam’s has ever received such abuse as The Donald has. After it was obvious that Biden had won, an MSNBC anchor by the name of Joy Reid complained of a “great amount of racism, anti-blackness ,and anti-wokeness.” What the hell? A blowhard by the name of Charles Blow of the Bagel Times went a step further: “It confirmed the power of White Patriarchy.”

Just imagine if the wokes had lost, what the rhetoric would sound like. One Jane Mayer, who hates rather a lot and would have envied but despised my dinner guests, writes in the magazine whose star writer was caught in flagrante masturbating on Zoom a couple of weeks ago, how Trump must feel like “a terrified little boy” because he will soon be “running from the law.” She then calculates that The Donald will abscond to a foreign country that has no extradition with the U.S. Hers is a long-winded article of hate and speculation about preventing a president from pardoning himself and how a corrupt president is a danger to the country.

I am used to the lies of the left, the quelling of free speech by Big Tech that runs counter to their PC culture, but what surprises me is how the people who own these media outlets—people whose grandparents and ancestors started out dirt-poor in the ghettos of Eastern Europe, came to America, worked hard, and prospered beyond their wildest dreams because of free enterprise—allow their editors to wage unremitting war against the country and the system that gave them their opportunity. The Sulzbergers, Bezoses, Newhouses, Zuckerbergs, and Dorseys of this world.

Never mind. The Donald was raged against from day one. Globalists, academia, the media, and the entertainment industry viewed him as a 21st-century Hitler. Now that 70 million Americans voted for him, the cultural elite has a new enemy, the 70 million who did. These “deplorables” are working-class men and women who go to church, work hard, obey the law, and respect tradition and their past.

Read more

I can picture Big Tech and media big shots asking each other where in hell did these blacks and Hispanics who voted for the monster come from? Who the hell are these yokels who never went to college to resist us so flagrantly? University grads mainly voted for Joe. High school grads went for The Donald. The elite are up in arms. So there you have it: Trump did not help his case by whining after losing. Decorum and dignity in defeat were never his strong points. My little dinner party was an oxymoron. We lost but took defeat elegantly. Michael Mailer did not gloat. Mind you, we were all so drunk by the time it was over, some of us were cheering that Eisenhower had beaten Stevenson. But those were the good old days. When JFK won the 1960 election by stealing West Virginia and Illinois, Richard Nixon refused to challenge for the sake of the country. Back then it was called patriotism, now only suckers play that game.

First Comes a Rolling Civil War

Biden is on a double precipice of the worst-ever economic depression coupled with imminent explosions of social rage

By Pepe Escobar

Asia Times

November 16, 2020

The massive psyops is ongoing. Everyone familiar with the Transition Integrity Project (TIP) knew how this would imperatively play out. I chose to frame it as a think tank gaming exercise in my Banana Follies column. This is a live exercise. Yet no one knows exactly how it will end.

US intel is very much aware of well-documented instances of election fraud. Among them: NSA software that infiltrates any network, as previously detailed by Edward Snowden, and capable of altering vote counts; the Hammer supercomputer and its Scorecard app that hacks computers at the transfer points of state election computer systems and outside third party election data vaults; the Dominion software system, known to have serious security issues since 2000, but still used in 30 states, including every swing state; those by now famous vertical jumps to Biden in both Michigan and Wisconsin at 4am on November 4 (AFP unconvincingly tried to debunk Wisconsin and didn’t even try with Michigan); multiple instances of Dead Men Do Vote.

The key actor is the Deep State, which decides what happens next. They have weighed the pros and cons of placing as candidate a senile, stage 2 dementia, neocon warmonger and possible extorsionist (along with son) as “leader of the free world”, campaigning from a basement, incapable of filling a parking lot in his rallies, and seconded by someone with so little support in the Dem primaries that she was the first to drop out.

The optics, especially seen from vast swathes of the imperial-interfered Global South, may be somewhat terrible. Dodgy elections are a prerogative of Bolivia and Belarus. Yet only the Empire is able to legitimize a dodgy election – especially in its own backyard.

Welcome to the New Resistance

The GOP is in a very comfortable position. They hold the Senate and may end up picking up as may as 12 seats in the House. They also know that any attempt by Biden-Harris to legislate via Executive Orders will have…consequences.

The Fox News/ New York Post angle is particularly enticing. Why are they suddenly supporting Biden? Way beyond internal family squabbles worthy of the Succession saga, Rupert Murdoch made it very clear, via the laptop from hell caper, that he has all sorts of kompromat on the Biden family. So they will do whatever he wants. Murdoch does not need Trump anymore.

Five Swing States to Decide US Presidential Election

Nor, in theory, does the GOP. Former CIA insiders assure of serious backroom shenanigans going on between GOP honchos and the Biden-Harris gang. Trade-offs bypassing Trump – which most of the GOP hates with a vengeance. The most important man in Washington will be in fact GOP Senate majority leader Mitch McConnell.

Still, to clear any lingering doubts, a vote recount would be absolutely necessary in all 6 contested states – WI, MI, PA, GA, NV and AZ. Through hand counting. One by one. The DoJ would need to act on it, immediately. Not gonna happen. Recounts cost a ton of money. There’s no evidence Team Trump – on top of it short of funds and manpower – will be able to convince Daddy Bush asset William Barr to go for it.

While relentlessly demonizing Trump for spreading “a torrent of misinformation” and “trying to undermine the legitimacy of the US election”, mainstream media and Big Tech have declared a winner – a classic case of pre-programming the sheep multitudes.

Yet what really matters is the letter of the law. State legislatures decide whose electors go to the Electoral College to appoint the President.

Here it is – Article II, Section 1, Clause 2: Each state shall appoint electors “in such Manner as the Legislature Thereof May Direct.”

So this has nothing to do with governors, not to mention the media. It’s up to GOP state legislatures to act accordingly. The drama may roll out for weeks. The first step of the Electoral College procedure takes place on December 14. The final determination will only happen in early January.

Meanwhile, talk of a New Resistance is spreading like wildfire.

Trumpism, with 71 million + votes, is firmly established as a mass movement. No one in the GOP commands this kind of popular appeal. By sidelining Trumpism, the GOP may be committing seppuku.

So what will Deplorables do?

The always indispensable Alastair Crooke hits the nail on the head in a powerful essay: Trump is the President of Red America. And depending on how the scripted (s)election tragicomedy develops next, the Deplorables are bound to become The Ungovernables.

Crooke references a crucial parallel evoked by historian Mike Vlahos, who shows how the current American saga mirrors Ancient Rome in the last century of the Republic, pitting the Roman elite against the Populares – which today are represented by Red (Trumpist) America:

“This was a new world, in which the great landowners, with their latifundia [the slave-land source of wealth], who had been the ‘Big Men’ leading the various factions in the civil wars, became the senatorial archons that dominated Roman life for the next five centuries — while the People, the Populares, were ground into a passive — not helpless — but generally dependent and non-participating element of Roman governance: This sapped away at the creative life of Rome, and eventually led to its coming apart.”

So as much as the Dem machine had wanted it, Trump is not yet Imperator Caesar Augustus, whom the Greeks called Autokrator (autocrat), but was a de facto monarch. The American Augustus, Tiberius and most of all Caligula is still further on down the road. He will definitely be a benign, humanitarian imperialist.

In the meantime, what will imperial Big Capital do?

The West, and especially the American Rome, is on the edge of a double precipice: the worst economic depression ever, coupled with imminent, myriad, uncontrollable explosions of social rage.

So the Deep State is reasoning that with Biden – or, sooner rather than later, Supreme shakti and Commander-in-Chief Maa Durga Kamala – the path gets smoother towards the Davos Great Reset. After all, to reset the chess pieces, first the chessboard must be knocked over. This will be one step beyond Dark Winter – which not accidentally was evoked by teleprompter-reading Biden himself on the final presidential debate. The script gets ominously closer to the Rockefeller Foundation’s 2010 Lock Step.

Meanwhile, Plan B is kept in ready, steady, go mode: the lineaments of a global rampage, focused on “malign” Russia’s sphere of influence to satisfy a “revived” NATO and the military-industrial complex, which selected the now media-appointed President-Elect in the first place because he’s no more than a pliant cardboard figure.

https://in-this-together.com/covid-19-evidence-of-global-fraud/

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.

It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.

S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.

E gene (Orf1ab) – small membrane protein used in viral assembly

N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .

Prince Charles telling us to embrace the Great Reset

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite there immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

Trump’s Re-Election is Certain. Constitutional video lesson from both the LEFT and RIGHT demonstrates HOW and WHY…

November 14th, 2020

One of the unintended consequences that will bite the Democrats in the ass from all the fraud they committed in this election is the American people are FINALLY re-learning historic lessons about the Constitution in REAL time.

MOST people are unaware of the brilliance of our Founding Fathers in planning ahead to handle any political scenario that may manifest itself in a presidential election, even one that is wrought with fraud.

FIRST watch this video from my good friend, Bill Whittle. I have not shared a Bill Whittle video with you in some time. This one is too good not to pass on to you. Bill exposes more of what I have been telling you about the subtle and the flagrant gaslighting by the media. You will love this video…

NOW, watch these two short videos for a Constitutional education on presidential elections. One video from the RIGHT and the other from the LEFT. In both cases, the result is the same… President Trump is re-elected.

Watch the video from the RIGHT perspective first:

Now the perspective from the LEFT:

In both cases, MUCH to the dismay of the LEFT, President Trump is re-elected.

President Trump WILL NOT concede and he SHOULD NOT concede BECAUSE THE DEMOCRATS RUINED THE ELECTION PROCESS WITH THEIR SYSTEMIC FRAUD.

Now it is time for Democrats to pay the price as our Founder’s planned, when elections are not legitimate.

There is NO QUESTION at this point that the 2020 Presidential Election is NOT legitimate. Even the Chairman of the Federal Election Commission agrees with me.

Trey Trainor, the Chairman of the Federal Election Commission, stated during an appearance on Newsmax that he “does believe there’s voter fraud taking place,” and confirmed that the refusal to allow poll watchers to observe the ballot counting process — among numerous other irregularities — does indeed constitute an “illegitimate election.”

Here is Trey Trainor, chairman of the Federal Election Commission…

Now watch this new video and see MORE CAPTURED VIDEO EVIDENCE of WHY the Chairman of the Federal Election Commission and 73 million Americans don’t just believe this election was rigged, they can SEE IT, in real time, being stolen from Donald Trump…

President Trump just received a big victory from a judge in Pennsylvania. The ruling will throw out THOUSANDS of votes that came into the PA voting precincts with no voter identification.

This does not take into account the even BIGGER case he will ultimately present to the Supreme Court, over the illegal voting rule changes in PA, but this ruling will certainly help his case against the state of Pennsylvania in the Supreme Court.

Believe it or not, you would think such news would be FRONT PAGE as it is the FIRST of MANY anticipated favorable rulings Trump will receive on voter fraud and voter irregularities he claims stole the election from him in the hours and days following 8pm on November 3.

Maybe I am on top of this so much that I am catching news as soon as it is released, but I had a very difficult time finding ANY video coverage of this important ruling on the news feeds, showing once again the absolute media bias against presenting anything positive for our President, Donald Trump.

Here is the video explaining the judge’s decision in favor of Trump in Pennsylvania. This is the beginning of MANY similar rulings we will see as the Trump Team presents all the legal challenges and evidence they are compiling to prove the historic and unprecedented amount of voter fraud the Democrats committed in their attempted theft of the presidential election. HOLD FIRM WITH TRUMP. HE WILL WIN!

President Trump’s legal case is building momentum with stronger and stronger evidence and more whistleblowers coming forward.

Here is the former Attorney General of Nevada stating he has evidence that over 600,000 mail in votes in Nevada had NO human signature verification and the polling places reduced the automated signature verification down to a 40% match rendering the machines essentially useless. See this video…

And Rudy Giuliani, President Trump’s personal attorney reveals that whistleblowers from Dominion Software have now come forward with evidence of the vote changing scheme that electronically changed votes from Trump to Biden as I revealed to you in my previous e-mails. See this video…

And it looks like we are going to receive in Georgia, the Forensic Ballot Audit I suggested several e-mails ago. This is the start. First Georgia, then the rest of the swing states will follow, where massive voter fraud has occurred. See this video…

And if you want to see how desperate the corrupt factions of our own government are in their attempts to sweep the massive voter fraud under the rug, watch these three videos, in order, to see on Video 3 the Deep State’s efforts to silence the truth, and allow the theft of a presidential election…

I have written to you about gaslighting numerous times in the past. Gaslighting is a form of psychological abuse in which false information is presented with the intent of making a victim doubt his or her own memory, perception, and sanity. The liberal media and Radical Left have been gaslighting us for decades but put their gaslighting campaigns on steroids since President Trump won the election in 2016.

In video 3 you see a sample of the psychological manipulation this federal agent is using to break down a direct witness of voter fraud, in an attempt to get him to doubt what he saw and heard. This type of illegal and corrupt activity ONLY HAPPENS TO SUPPRESS THE TRUTH, WHEN THE TRUTH WILL EXPOSE AND DEFEAT DARK FORCES IN A GOVERNMENT.

Everyone, including Democrats should denounce such tactics. What you are witnessing in Video 3 is what you would see in a re-education camp of a communist regime. This is DEEP STATE GASLIGHTING! WE MUST FIGHT THIS!

These types of gaslighting attacks would not occur unless we are impinging on the corruption and fraud of this election. These efforts to gaslight witnesses indicate we are winning.

The evidence is coming in so fast I cannot keep up with it.

Here are just a few videos to show you even more evidence…

Ultimately, the decision over this election will fall to the Supreme Court. After all the lawsuits are filed and all the decisions in the lower courts, for or against Trump, are advanced to the Supreme Court, nine justices will decide the election the way they did in 2000, when Al Gore and the media claimed Gore was President of the United States.

There are some old, wise sayings, “What goes around comes around” and “You get what you give.” The Supreme Court is a BIG problem for Joe Biden and Kamala Harris.

Here’s why…

Oh Joe, you reap what you sow…

Trump’s attorneys have NUMEROUS constitutional based arguments to place in front of the Supreme Court over the evidence of systemic, electronic voter fraud by the Democrats. They are gathering the evidence now and preparing to appropriate legal briefs.

Attorney General William Barr has just authorized federal prosecutors across the country to “pursue substantial allegations” of voting irregularities. He states, “I authorize you to pursue substantial allegations of voting and vote tabulation irregularities prior to the certification of elections in your jurisdictions in certain cases, as I have already done in specific instances. Such inquiries and reviews may be conducted if there are clear and apparently credible allegations of irregularities that, if true, could potentially impact the outcome of a federal election in an individual State.”

There are TONS of “substantial allegations” and Barr is handing the investigations over to the top state prosecutors to bypass the “do nothing” district attorneys in the Democratic controlled cities where the fraud was most widespread.

Barr’s actions are a BIG move in the right direction for President Trump.

Here is another action for Trump directed at the Supreme Court:

A group of 10 attorneys general on Monday filed an amicus brief in support of a lawsuit from Pennsylvania Republicans and asked the U.S. Supreme Court to overturn a ruling that extended the deadline for mail-in ballots in the state. Missouri Attorney General Eric Schmitt, who led the amicus brief, said that the Pennsylvania Supreme Court had rewritten the law and encroached on the legislature’s authority when it ruled that mail-in ballots received a few days after the election can still be counted.

The Pennsylvania Supreme Court ruled on Sept. 17 that election officials can accept all mail-in ballots, including absentee ballots, up to three days after Nov. 3, Election Day, citing the COVID-19 pandemic for the extension. Pennsylvania’s Republican leaders and state lawmakers, along with President Donald Trump’s campaign, have asked the U.S. Supreme Court to toss out Pennsylvania’s ruling and throw out all post-Election Day ballots. Ohio Attorney General Dave Yost also filed a separate amicus brief on Monday, and Oklahoma Attorney General Mike Hunter is expected to file an amicus brief on Tuesday over the same case. The Supreme Court has yet to decide on whether to review the case.

Amicus (friend of the court) briefs are a way for outside parties to provide information and perspective to a legal case. Schmitt was joined by nine other Republican attorneys general representing the states of Louisiana, Alabama, Arkansas, Florida, Kentucky, Mississippi, South Carolina, South Dakota, and Texas.

Just because the News Media announced Joe Biden as the 46th President. This does not mean he has won. Votes need to be certified by the states. Elections are certified once every vote is counted and all outstanding legal issues are sorted. As you know there are MANY outstanding legal issues in this election.

The Republicans have discovered what happened. It is just a matter of time now to prosecute their case in the courts. Watch these videos for the truth about what happened on election night and beyond. It is corrupt. It is criminal. It is treasonous. Heads should roll over what they did to you.

And here is more explanation how the Hammer/Scorecard fraud occurred, BUT MORE IMPORTANTLY, the TRUTH that the Republican controlled legislatures in these swing states involved CAN ACTUALLY DECIDE THIS ELECTION FOR TRUMP BY APPOINTING ELECTORS TO THE ELECTORAL COLLEGE WHO WILL APPLY THEIR ELECTORAL COLLEGE VOTES FOR TRUMP!

We are living in a time of history that will be talked about for generations to come. We either stand with President Trump to save our Republic or we turn a blind eye to the criminal fraud and corruption of the Democratic party, and forever live in a country controlled by Big Tech, Bias Media, and Criminally Corrupt Political Operatives!

Want to see the electronic fraud in real time? Watch this…

And watch this to learn the executive who runs the software company committing the fraud and who is a major shareholder in the software company committing the fraud…

STAND FIRM WITH TRUMP NO MATTER HOW LONG IT TAKES.

There is a deadline for certifying the results of the election, and it varies by state. Most states must be done by the end of November, but temporary restraining orders (TRO’s) and injunctions can be issued by judges to override deadlines when there are issues of fact in legal claims and evidence supporting extending the election certification deadlines.

President Trump is filing litigation over numerous issues of voter irregularities, fraud, illegal changes in the voter rules, etc.

I believe the Trump legal team should demand a FORENSIC BALLOT AUDIT. Much like a forensic financial audit, where every financial item is not only verified, but the authenticity and paper trail of the item is also determined, so must EACH AND EVERY VOTE in a forensic ballot audit.

Starting with every vote in Pennsylvania, each vote should be forensically investigated, at a minimum, to determine the following:

Is the vote from a LIVE, IN STATE, REGISTERED VOTER? If not, throw it out.

Does the ballot have a signature that matches the voter registration card? If not, throw it out.

Is the vote the ONLY vote from an IN STATE, REGISTERED VOTER? If not, throw out ALL votes from that voter as the voter violated Federal Election Laws. Then arrest that voter and prosecute him or her for voter fraud.

Was the vote received or postmarked by November 3, 2020. If not, throw it out.

Was the vote received at the voter polling station by 8pm on November 3, postmarked or not? If not, throw it out.

Was the vote tampered with, illegible, or marked in any manner that does not demonstrate a clear vote for either candidate? If so, throw it out.

Did the vote as marked, actually record for the proper candidate when entered in the electronic scanner? If not, take a vote away from the candidate who received the improper credit and credit the proper candidate.

ALL votes received AFTER 8pm on November 3 in “dumps” must be sourced back to the original location that they came from and individuals involved in delivering the “dumps” must be questioned intensely to determine who was behind the dumping of votes in the wee hours of the morning on November 4 and beyond. Anyone involved in the fraudulent dumping should be arrested and prosecuted.

EVERY polling worker in every voter precinct of the key states in this election should be interviewed under immunity to give them an opportunity to come forward and disclose any voter fraud they witnessed or were instructed to perform by their supervisors or Democratic operatives.

EVERY postal worker in the state, should be given the opportunity under immunity to come forward and disclose any voter fraud they witnessed or were instructed to perform by their supervisors or Democratic operatives.

After Pennsylvania, the rest of the states that Trump was winning before the vote count was halted on November 3 must also undergo a forensic ballot audit.

YES, this will be TIME CONSUMING, EXPENSIVE, and POLITICALLY BLOODY, but NOW is the time that we MUST DEMAND a forensic ballot audit and smoke out all the fraud the Democrats perpetrated on the American people in this election.

If we do not make a stand NOW and fight for fair and transparent elections, we will never have a fair election again.

WE MUST EXPOSE the CORRUPTION and FRAUD of the 2020 Presidential Election or we will never have a fair election again.

If the Democrats get away with what they did this time, you will never see anyone other than a Democrat win an election again. And the midterms elections are coming up in two years!

The Democrats, if allowed to get away with what they did to Donald Trump, will do to the Senate race in two years, what they just did to the presidential race.

As we saw starting on the evening of November 3, when the count was halted with Trump winning big, through today where the Biden Vote Dumps keep showing up, no RED WAVE, no matter how big, can overcome systemic voter fraud and corruption by the Democrats.

Donald Trump SHOULD NOT and WILL NOT concede the election. I will give you all the ammunition you need to defend the President’s actions in a moment, but first let me warn you…

It is going to get ugly for Donald Trump and people like us, his supporters. RINO Republicans (Republicans In Name Only) like Presidential-Loser-Without-a-Fight, Mitt Romney are going to start imploring Trump to concede “for the unity for the country.”

As we get into December, the left wing radical mobs will start filling the streets of every major city demanding that President Trump step down. Rioting and looting and burning down these cities will occur in greater frequency than we have ever seen. The violence will spill into the suburbs. The White House will be surrounded 24 hours a day with protests and violence, demanding President Trump step down.

The media will castigate Trump and people like you and me for not stepping aside for Biden, and blame us for the violence.

YES, this will get ugly. Yes it will be politically bloody. But NOW is the time that we MUST FIGHT FOR WHAT IS RIGHT. If we do not make a stand NOW and fight for fair and transparent elections, we will never have a fair election again. WE MUST EXPOSE the CORRUPTION and FRAUD of the 2020 Presidential Election to save America.

Donald Trump SHOULD NOT and WILL NOT concede the election.

Just remember, what we must overcome in the next weeks or months is NOTHING compared to what our Founding Fathers overcame to give us our freedom. We can do this and we MUST do this. The future of America is in our hands. We must do what our Founding Fathers would do, if they were here today.

This election was fraudulent from the start with all the voting rule changes that were made without proper legal authority.

This election was fraudulent from the start with all the ballots that were mailed out unsolicited.

This election was fraudulent from the start with the voting software that was used.

Here is just SOME of the proof for you to STAND FIRM with President Trump in his unwillingness to concede an election that was rigged from the start to be stolen for you.

From CBS News, TWO months BEFORE the election as Democrats filed lawsuits to allow massive, unsolicited mail in ballots and remove matching signature requirements. This was premeditated fraud…

CBS News

Washington — With Election Day 50 days away, the 2020 election battle is being waged not only on the campaign trail, but also in courtrooms around the country, as efforts to alter voting procedures during the coronavirus pandemic have spawned a barrage of legal challenges and left the presidential campaigns amassing armies of lawyers ready to fight after the ballots are cast.

As of August 31, there have been at least 245 coronavirus election cases filed in 45 states, the District of Columbia and Puerto Rico, according to Justin Levitt, a professor at Loyola Law School, who has been tracking the disputes that seek to shape the election rules. He says he started counting the cases a few months ago. Now, he writes, “I’ve tracked quite a lot of them. (And I’m 100% sure I’m missing some.)”

Election law experts say each cycle tends to bring with it an uptick in new lawsuits, but this year is unique.

One of the biggest and most recognized illegal and fraudulent change in the voting rules is in Pennsylvania, where Democrats, who could not get the legislature to change the rules, went to the Pennsylvania courts to illegally change the voting rules. Only the Pennsylvania legislature can make changes to voting rules. This was already in front of the US Supreme Court to decide the merits of the case, but Justice Roberts with only 8 justices on the Court, kicked the can down the road, hoping it would not be an issue that the Supreme Court would need to decide. Well NOW, they will need to decide it with a 6-3 conservative Court. The Supreme Court will be deciding MANY other cases related to this fraudulent election as well.

And here is the an example of what happens when Democrats fraudulently mail out TONS of unsolicited ballots and remove signature matching requirements. People who have died but are still on registration rolls receive ballots mailed to their last known address. People who have moved out of state, but a ballot is sent to their last known address. MULTIPLE ballots being sent to the same person. What happens in this fraudulent situation? LEGAL VOTES ARE NULLIFIED BY ALL THE ILLEGAL VOTES MAILED IN.

And then there is the Technology Fraud of this election. Think this was an accident? Read this…

HUGE! Corrupted Software Used in Michigan County that Stole 6,000 Votes from Trump — Is Also Used in ALL SWING STATES — PA, GA, NV, MI, WI, AZ, MN!

By Jim Hoft

Published November 6, 2020 at 8:35pm

GOP Chair

A so-called computer “glitch” fix in one of Michigan’s counties has led to 6,000 votes switching from Joe Biden to President Trump. The Head of the Republican Party has asked for an additional 47 counties be recounted after the fix since these 47 counties also use the same Dominion software.

A so-called computer glitch has been uncovered in Michigan today and it resulted in swapping 6,000 votes from Joe Biden to President Trump.

Dominion Software is used in 28 US states including ALL OF THE BATTLEGROUND STATES.

The Dominion software “glitch” ONLY took votes from President Trump and Republicans.

Dominion is used in 30 different states.

FS Image

Dominion is used in EVERY SWING STATE!

Nevada Arizona Minnesota Michigan Wisconsin Georgia Pennsylvania

And NUMEROUS COUNTIES in Georgia also used the software!!

This is turning into a MASSIVE scandal!

Democrats thought this “glitch” would be enough to beat Donald Trump.

They had no idea he would have the greatest landslide and vote totals in US history!

So then they had to dump Hundreds of Thousands of ballots in to the swing states they lost!

The fraud of the ballot dumping is best demonstrated by the statistical IMPOSSIBILITY of 100% of the votes in the late night, after election day has passed ballot dumps going to Joe Biden. Read this…

What Are the Impossible Odds of 139,339 Ballots all Going to Biden?

Ammoland Inc. Posted on November 5, 2020 by Don McDougall

So let me start; my BA is in applied mathematics out of UCLA. Besides writing occasional gun articles, I use these skills every day for Green Energy Consulting.

When I saw reports that a block of 2020 Presidential absentee ballots turned up all 100% for Biden, a so-called “error” that was later corrected when called out by conservative reporters; I asked the question, is that likely or even mathematically possible?

The answer is simple NO; it is not. So here’s why and how you calculated the estimates.

Consider a coin; you flip it, what are the odds that it would come up heads. Well, 50/50, right? The chance of two heads in a row is 25% Three heads in a row 1 in 8. The possible patterns look like this. (H stands for heads, T for tails)

HHH HHT HTT HTH THH THT TTH TTT

Only one of the eight possible options is all heads. Try it for yourself.

Assuming 139,339 “found” ballots, what are the odds that they are all for Biden, one of the worst candidates for President in our history?

First off, we have to weigh the chances of a Biden ballot. All early ballots mailed a week ago from a democratic stronghold. Let’s be generous and say 90% of those ballots are for Biden. (.80)139,339

Now let’s make the math easy, how many times out of 100 ballots being pulled, given 90% of the ballets would be for Biden, would you get all Biden Ballots?

2.65 times out of 100,000. Or 1 out of every 38,000 times. Now, this is just for 100 ballots. For 139,339 ballots, the odds are just about infinitesimal. So close to zero that the calculation has 1000+ zeros.

If I use 1,000 ballots, the odds are 0.000000000000000000000000000000000000000000000174787125172274 to 1.

Printing out the odds number for 139.339 ballots would fill the page with zeros.

Now consider this, we see lots of 10,000’s ballots bunches turn up, all for Biden in every democratically controlled state. The odds of 1,000 ballots all-for-one candidate are so close to zero as statistically impossible. (The increases in the odds are geometric, not linear, by the way.) The odds of 10,000 ballots, let alone 139,339 ballots are even worse.

We are witness to the most incredible national effort at voter fraud in American History, and the people involved have no shame or remorse. The media is complicit in not covering these issues.

“There’s more to an election than mere votin’, my boy, for as an eminent American once said: ‘I care not who casts the votes of a nation if they’ll let me make the count. ‘” — from Uncle Henry, a novel by George Creel, 1922.

And of course, there is the video where Biden actually tells the truth. Of course, he is going to claim this was just a slip of the tongue. REALLY? This is the definition of Freudian Slip (of the tongue)

A Freudian slip, also called parapraxis, is an error in speech, memory, or physical action that occurs due to the interference of an unconscious subdued wish or internal train of thought.

Here is Joe Biden, admitting what he has REALLY done…

So NO, President Trump WILL NOT and SHOULD NOT concede his election. This was a fraudulent election from BEFORE November 3, THROUGHOUT November 3, and WELL AFTER November 3.

Thank God that Trump is a fighter and he is willing to fight for Truth, Justice, and the American Way.

The BIG QUESTION is WHAT TO DO ABOUT IT and HOW TO BEST FIGHT?

THERE ARE MANY SOULTIONS and THEY ALL MUST BE USED. This will be TIME CONSUMING and EXPENSIVE, BUT MUST BE DONE TO SAVE FREEDOM AND FAIR ELECTIONS

Here is one of the many solutions I will share with you as we move through the months or even years that TRUMP fights for us.

Trump is going to expose the Democratic Party’s corruption and voter fraud that Republicans have complained about for years, through all the lawsuits and investigations needed to prove voter fraud.

Donald Trump has the Combat Mindset we teach students to demonstrate, when confronted with a lethal encounter: focused, overwhelming, controlled aggression. In Trump’s case it is a “legal” encounter involving what he believes is voter fraud. He will attack the Democrats with focused, overwhelming, controlled, legal aggression.

We have never had a candidate like Trump who is willing to take the fight to the Democrats with focused, overwhelming, aggressive, legal force.

He will defeat the Democrats and the Liberal Media, through the Supreme Court if he must, to claim his rightful victory in a FAIR election we all voted for…

Donald J Trump

This could get ugly before it is resolved.

There could be civil unrest and violence by the radical left like we have never seen before in this country.

It is time to get YOUR ENTIRE FAMILY trained.

If you have not already done so, simply take advantage of my offer BELOW to train you in a $2,000 Four Day Defensive Handgun Course absolutely FREE OF CHARGE, with no hidden surprises, catches or obligations that you can use at any time in the future, with no expiration date, or transfer to anyone who has not yet attended a course at Front Sight.

Forward this email to EVERYONE YOU KNOW AND CARE ABOUT and encourage them to get trained and prepared for the future, should this fraud on the American people escalate into a situation where we must protect and defend ourselves and families.

It all starts with you becoming a walking, talking representative of safe, responsible, proficient and expertly-trained gun ownership, by grabbing your free course! Get it here:

Front Sight Video

And remember, once you secure your course to use at any time in the future, I can give you even more amazing benefits and bonuses, including placing $100 in the Front Sight account you establish when you secure your free handgun course and give you the opportunity to get free guns… LOTS of free guns.

There is a reason why my hundreds of thousands of students and members call me the Millionaire Patriot. It’s time for you to find out why too!

Sincerely,

Dr. Ignatius Piazza Founder and Director Front Sight Firearms Training Institute 7975 Cameron Drive, #900 Windsor, CA 95492 http://www.frontsight.com info@frontsight.com 1.800.987.7719


composite of articles 11-17

Everybody Knows the Fight was Fixed

By Edward Curtin

At the end of Henrik Ibsen’s classic play, A Doll’s House, Nora, the aggrieved wife, leaves her husband’s house and all the illusions that sustained its marriage of lies. She chooses freedom over fantasy. She will no longer be played with like a doll but will try to become a free woman – a singular one.

“There is another task I must undertake first. I must try and educate myself,” she tells her husband Torvald, a man completely incapable of understanding the social programming that has made him society’s slave.

When Nora closes the doll’s house door behind her, the sound is like a hammer blow of freedom. For anyone who has seen the play, even when knowing the outcome in advance, that sound is profound. It keeps echoing. It interrogates one’s conscience.

The echo asks: Do you live inside America’s doll house where a vast tapestry of lies, bad faith, and cheap grace keep you caged in comfort, as you repeat the habits that have been drilled into you?

In this doll’s house of propaganda into which America has been converted, a great many of our basic assumptions are totally illusory.

Americans who voted for either Trump or Biden in the 2020 election are like Torvald clones. They refuse to open that door so they might close it behind them.

No Advertising - No Government Grants - No Algorithm - This Is Independent Media

Get Our Free Newsletter

You can't buy your way onto these pages

They live in the doll’s house – all 146+ million of them. Like Torvald, they are comforted. They are programmed and propagandized, embracing the illusion that the electoral system is not structured and controlled to make sure no significant change can occur, no matter who is president. It is a sad reality promoted as democracy.

They will prattle on and give all sorts of reasons why they voted, and for whom, and how if you don’t vote you have no right to bitch, and how it’s this sacred right to vote that makes democracy great, blah blah blah. It’s all sheer nonsense. For the U.S.A. is not a democracy; it is an oligarchy run by the wealthy for the wealthy.

This is not a big secret. Everybody knows this is true; knows the electoral system is sheer show business with the presidential extravaganza drawing the big money from corporate lobbyists, investment bankers, credit card companies, lawyers, business and hedge fund executives, Silicon Valley honchos, think tanks, Wall Street gamblers, millionaires, billionaires, et. al. Biden and Trump spent over 3 billion dollars on the election. They are owned by the money people.

Both are old men with long, shameful histories. A quick inquiry will show how the rich have profited immensely from their tenures in office. There is not one hint that they could change and have a miraculous conversion while in future office, like JFK. Neither has the guts or the intelligence. They are nowhere men who fear the fate that John Kennedy faced squarely when he turned against the CIA and the war machine. They join the craven company of Johnson, Ford, Carter, Reagan G.H.W. Bush, Clinton, George W. Bush, and Obama. They all got the message that was sent from the streets of Dallas in 1963: You don’t want to die, do you?

Ask yourself: Has the power of the oligarchic, permanent warfare state with its propaganda and spy networks, its vast intelligence apparatus, increased or decreased in the past half century? Who is winning the battle, the people or the ruling elites? The answer is obvious.

It matters not at all whether the president has been Trump or Bill Clinton, Ronald Reagan or George W. Bush, Barack Obama or George H. W. Bush, Richard Nixon, Gerald Ford, or Jimmy Carter. The power of the national security state has grown under them all and everyone is left to moan and groan and wonder why.

All the while, the doll’s house has become more and more sophisticated and powerful. It is now essentially an electronic prison that is being “Built Back Better.” The new Cold War now being waged against Russia and China is a bi-partisan affair, as is the confidence game played by the secret government intended to create a fractured consciousness in the population through their corporate mass-media stenographers. Trump and his followers on one side of the coin; liberal Democrats on the other.

Only those backed by the wealthy power brokers get elected in the U.S.A. Then when elected, it’s payback time. Palms are greased. Everybody knows this is true. It’s called corruption. So why would anyone, who opposes a corrupt political oligarchy, vote, unless they were casting a vote of conscience for a doomed third-party candidate?

Leonard Cohen told it true with “Everybody Knows”:

Everybody knows that the dice are loaded

Everybody rolls with their fingers crossed

Everybody knows that the war is over

Everybody knows the good guys lost

Everybody knows the fight was fixed

The poor stay poor, the rich get rich

That’s how it goes

Everybody knows

Everybody knows that the boat is leaking

Everybody knows that the captain lied

Everybody got this broken feeling

Like their father or their dog just died

And yet everybody who voted for the two men backed by the super-rich owners of the country knew what they were doing, unless they live under a rock and come out every four years to vote. Perhaps they were out buying stuffing for the Thanksgiving turkey, so they can give thanks for the farce (stuffing: Latin: farcire ).

They have their reasons. Now the Biden people celebrate, just as Trump’s supporters did in 2016. I can hear fireworks going off as I write here in a town where 90% + voted for Biden and hate Trump with a passion more intense than what they ever could work up for a spurned lover or spouse. This is mass psychosis. It’s almost funny.

At least we have gotten rid of Trump, they say. No one can be worse. They think this is logic. Like Torvald, they cannot begin to understand why anyone would want to leave the doll’s house, how anyone could refuse to play a game in which the dice are loaded. They will deny they are in the doll’s house while knowing the dice are loaded and still roll the die, not caring that their choice – whether it’s Tweedledee or Tweedledum – will result in the death and impoverishment of so many, that being the end result of oligarchic rule at home and imperialism abroad.

Orwell called this Doublethink:

Doublethink means the power of holding two contradictory beliefs in one’s mind simultaneously, and accepting both of them…. To tell deliberate lies while genuinely believing in them, to forget any fact that has become inconvenient, and then, when it becomes necessary again, to draw it back from oblivion for just so long as it is needed, to deny the existence of objective reality and all the while to take account of the reality which one denies – all this is indispensably necessary.

And while in Nineteen Eighty-Four Doublethink is learned by all the Party members “and certainly by all who are intelligent as well as orthodox,” today in the USA, it has been mastered even by the so-called unintelligent.

To live in the USA is to live in the Church of the Good Hustler.

People often ask: What can we do to make the country better? What is your alternative?

A child could answer that one: Don’t vote if you know that both contenders are backed by the super-rich elites, what some call the Deep State. Which of course they are. Everybody knows.

The so-called left and right argue constantly about whom to support. It’s a pseudo-debate constructed to allow people to think their vote counts; that the game isn’t rigged. It’s hammered into kids’ heads from an early age. Be grateful, give thanks that you live in a democracy where voting is allowed and your choice is as important as a billionaire’s such as Bill Gates, Jeff Bezos, or Charles Koch. In the voting booth we are all equal.

Myths die hard. This one never does:

Your voice, your hopes, and your dreams, will define our American destiny. And your courage and goodness and love will forever guide us along the way.”

Donald Trump, January 20, 2017

With the campaign over, it’s time to put the anger and the harsh rhetoric behind us and come together as a nation. It’s time for America to unite. And to heal.”

Joe Biden, November 7, 2020

Above all else, the time has come for us to renew our faith in ourselves and in America. In recent years, that faith has been challenged.”

Richard Nixon, January 20, 1973

Your voice – our faith – it’s time to unite and heal.

Ask the Vietnamese, the Iraqis, the Syrians, the Afghanis, the Libyans, the Palestinians, et al. They sing a different tune, one not heard In the Church of the Good Hustler.

After campaigning hard for the losing presidential candidate in 1972, I nearly choked when I heard Richard Nixon’s inaugural address in January 1973. Clinging to the American myth the previous year, I had campaigned for a genuine anti-war Democrat, Senator George McGovern.

The war against Vietnam was still raging and Nixon, who had been first elected in 1968 as a “peace candidate,” succeeding the previous “peace candidate” Lyndon Baines Johnson, was nevertheless overwhelmingly elected, despite Watergate allegations appearing in the months preceding the election. Nixon won forty-nine states to McGovern’s one – Massachusetts, where I lived.

It was a landslide. I felt sick, woke up, got up, and left the doll’s house.

“Propaganda is the true remedy for loneliness,” wrote the French sociologist Jacques Ellul in 1965 in Propaganda:

It corresponds to the need to share, to be a member of a community, to lose oneself in a group, to embrace a collective ideology that will end loneliness…. It also corresponds to deep and constant needs, more developed today, perhaps, than ever before: the need to believe and obey, to create and hear fables, to communicate in the language of myths.

In a country where loneliness is widespread, the will to believe and the power of positive thinking are far more powerful than the will to truth. Unlike Nora, who knew that when she left the doll’s house she was choosing the loneliness of the solitary soul, Americans prefer myths that induce them to act out of habit so they can lose themselves in the group.

This is so despite the fact that In the Church of the Good Hustler, when you play the game, you lose. We are all Americans and your vote counts and George Washington never told a lie.

-Edward Curtin - Educated in the classics, philosophy, literature, theology, and sociology, I teach sociology at Massachusetts College of Liberal Arts. My writing on varied topics has appeared widely over many years. I write as a public intellectual for the general public, not as a specialist for a narrow readership. I believe a non-committal sociology is an impossibility and therefore see all my work as an effort to enhance human freedom through understanding. http://edwardcurtin.com

The Global Capitalist Cage and the Corona Crisis: “Solutions” by Those Who Have Created “The Problems”

By Hiroyuki Hamada

Global Research, November 17, 2020

Global Research 23 October 2020

Theme: Media Disinformation, Police State & Civil Rights, Poverty & Social Inequality, Science and Medicine

capitalism

It’s hard to talk about the myriad issues piled in our society in a cohesive way, and when we try, we often get the same response: “What is your solution?” People get frustrated and demand an instant solution to the structural problem they are very much a part of. The very insistence on a single, cure-for-all-answer betrays their unwillingness to see the structural and systematic nature of the problem. Meanwhile they allow themselves “solutions” which are concocted by those who have created the problems.

Those “solutions” are bound to be strictly incremental and reformist, otherwise the self-serving nature of the overall trajectory becomes blatantly obvious. Confrontation with the flaws of the “solutions” triggers an emotional response: A clear indication that the criticism points to the obvious flaws of the system itself, which in turn resonates as a criticism against the self. The emotional burst and the denial to recognize the system for what it is are indications of pathological adhesion to abusive power. This is the condition that forces many American people to prop up the capitalist hierarchy and continue to prove their allegiance to it.

The real solution must involve a structural change. The feudal hierarchy which structurally imposes extortion schemes of money and violence on people by domesticating their humanity, to be harvested over and over within the capitalist framework, is inhumane and destructive to our species. Such an idea must not be brushed aside as untenable idealism if we are to live harmoniously with one another and with our environment.

Capitalist Cage

In the vastness of space and unimaginable span of geological time, our presence is small: smaller than a spec of dust on a whole planet. As conscious beings, we have created narratives and theories to explain what it means to be in this mysterious sea of matter and time. Such ideas are central to our social organization as well as how we relate ourselves to it. They very much affect how we perceive things as individuals and as collectives. Those ideas can take the shape of religion, history, ideology, tradition, myth and so on, constituting parts of the individual psyche as well as the collective psyche.

Those ideas are supposed to be promoted and perpetuated by the community members because they serve them by validating the given social order which serves their best interests. They are supposed to give us ways to reconcile with the unknown in collective manners, by which we find ways to accept the mystery of life with reverence and awe.

But do they?

As we are born into the social order, where those ideas are reinforced and physically manifest as social framework, we internalize those ideas, we become a part of the social mechanism and the ideas become “reality”.

But strictly speaking this “reality” is somewhat different from what is inherently real in a material sense. What we perceive as “reality” is our interpretation of matter which has been shaped by the imperatives of the social order.

For example, in a capitalist society, a fact can deviate from material reality because an institution which specializes in the fact is influenced by the interests of the ruling class. For example, industrial waste material can be dumped as a harmless substance. The effect of the lie increases progressively against the oppressed people since the profits are made with the expense of those who are exploited and subjugated by the lie. People suffer from the erroneous information but to different degrees. Those who suffer the most are subjected to the most strict measures, while those who exploit and subjugate can change the measures according to their needs while being well equipped to face material hardships.

Social institutions under capitalism always have the risk of failing since experts’ opinions are necessary to understand a complicated fact. People with bigger platforms can simply dominate the fact because people don’t have the time and resources to examine the fact. A louder opinion can simply get its way. The economic hierarchy ensures that those who have dire interests in getting the fact right can not get it right.

Now, this mechanism also works vertically. Different institutions are affected differently by the false fact. A fact twisted by the special interests creates conflicts among institutions. This creates conflicts among the people. However, the degree of the divisions get narrower and narrower as it gets closer to the level of the ruling class, where the lie can create broader benefits to the already wealthy and powerful people as they have the ability to access all moneyed institutions in creating “reality” that serves them. Dangerous policy, dangerous substance, dangerous practice and so on affect those who do not have the means to avoid them, while they can be part of enacting lucrative business schemes for the ruling class. We are put against each other in artificially scarce material conditions where we compete and form hierarchy based on the imperatives imposed by the capitalist framework, instead of according to the material facts.

A few major things happen from the lie. First, the ruling class succeeds in profiting from the exploitation and subjugation and/or succeeds in preserving the capitalist hierarchy. Second, the lie creates divisions among the oppressed. Third, the lie requires more lies to cover it up, depriving people’s ability to relate to themselves, to each other and to nature according to material reality.

The dynamic repeats itself in many ways, creating a false reality in which misinformation, disinformation and propaganda merge with facts as institutions are manipulated to serve the interests of the ruling class while the rest of the people are divided, confused and disempowered. The Founding Fathers of the US probably knew this mechanism very well when they installed “separation of powers” within the US government. The separation would effectively institutionalize the mechanism, ensuring that the interests of the people are checked and balanced by the ruling class which can have access to all branches of the government.

Moneyed social institutions as well as some “dissidents” and “community activists” can function as a crucial part of the capitalist hierarchy, maintaining and perpetuating the system regardless of their intentions. First, those who neglect to reveal the aims of the ruling class by solely pointing out criminal acts and refusing to recognize the mechanism of exploitation distract the people from what is really happening. Second, those who refuse to see the structural mechanism of exploitation within the capitalist hierarchy can end up protecting their own positions at the expense of the people at the bottom while serving the ruling class. Third, those who fail to recognize the lies or actively repeat them help facts to be subordinated to the capitalist framework while destroying the credibility and integrity of the social institutions, leading to destabilization of social relations—making us more susceptible to lies and manipulations. The paralyzed state can be utilized in further privatizing the institutions, resulting in more extensive domestication of humanity and nature.

These are only a few examples of how seemingly constructive social dynamics within the capitalist hierarchy can function to prop up the capitalist hierarchy. The risk of people truly recognizing the nature of the capitalist hierarchy, armed with experts and unity, is real as we observe instances of socialist revolutions across the globe. Capitalist institutions carefully accommodate those people who do not pose fundamental threats to the capitalist framework in maintaining the social structure that serves them.

Parasitic Tendency of Capitalism

Some may wonder, if the system is so fascistic and draconian, why it would allow “dissidents” to play a role in the social structure at all. It is because an authoritarian structure with commands, decrees, and rigid rules and their punitive consequences can not cultivate active social relations to prop itself up. Human minds can not free the potential of creativity to do so under such conditions . Just enough freedom to move within the cage is necessary for the capitalist hierarchy. Also, without allowing some degree of “freedom” within its framework, some people might establish communities with a true sense of freedom within the social structure, which can pose a threat to the system. For this reason, the illusion of safety and freedom are allowed within the capitalist framework. Within this environment, people engage in creative activities, the exchange of ideas and products, and the rest of the daily routines. These activities are guided by moneyed social institutions ensuring that the boundaries are set to perpetuate the capitalist framework. Governmental organizations, media, culture organizations, NGOs and so on play significant roles in ensuring that the subject population are domesticated within the framework.

Those organizations’ roles center on a moment by moment maintenance of the capitalist hierarchy. But they also curate acceptable “crises” within the structure in order to shift the direction of exploitation and subjugation in combatting unavoidable cyclical economic downturns (they are structurally unavoidable), and to continue deepening their colonization of humanity and nature. A country defying the capitalist hegemony might be called “a deadly threat to humanity” before bombs rain on its people. Population growth in certain countries might be termed “population bomb” before an assortment of colonial measures are implemented against them. The issues that generate profits and help augment the capitalist framework are ignored, or normalized no matter how enormous they are—cancer epidemic, drug epidemic, mass incarceration and so on and so forth, until the momentum to fight them becomes useful in perpetuating the capitalist hierarchy.

However, despite the efforts by the ruling class to construct the invisible prison for all, our creative energy can occasionally escape the artificial boundaries set by the capitalist domination. And some individuals could manage to garner the support of a broader population. However, they would be smeared by media, be attacked by various social institutions, or even be killed by government agencies. The element of fear is crucial in preventing our creative energy from going beyond the capitalist cage.

Fear of unknown must have been an essential perception of ours from the beginning of our species. Our efforts in understanding ourselves and our surroundings stem from it. Our sense of reverence toward nature, spirituality and so on stems from its mystery and unimaginable depth. The momentum to dominate by accumulation of wealth confronts fear of the unknown with its brute force. When capitalists destroy a pristine forest filled with wild lives and their intricate system, they destroy and colonize the natural environment while stealing the fear of unknown. When capitalists destroy cultures and traditions and replace them with a capitalist market, they destroy what they can’t steal in order to play God of Money.

Cultivation of fear

A protection racket scheme works the best when the service provider appears to be capable of inflicting the very violence that you wish to avoid. 9/11 is an embodiment of such a shady marketing strategy.

We are told what happened.

We are told to think accordingly.

But there are obvious inconsistencies— the failure of the Air Force to intercept the hijacked airplanes, suspicious lack of actions against the suspected hijackers prior to the attack by intelligence agencies, numerous testimonies indicating the presence of explosives in the 9/11 buildings, circumstantial evidence indicating that an event like 9/11 was necessary to embark on a series of colonial wars against the Middle East while curtailing the civil and legal rights of the people and so on. The authority itself doesn’t deny those points, as if to say “what are you gonna do about it?”

And we are told “you are either with us, or against us”.

9/11 has become the go-to justification for colonialism, corporatism and militarism for the empire. Countries that defy the western capitalist hegemony have been destroyed. People who defy it have been ridiculed, excluded, jailed or killed.

The obvious inconsistencies of the state policies simply turn into fear, which in turn strengthens the sale of the imperial protection racket. After all, the empire is armed with the sheer might of 800 military bases across the globe and numerous WMDs.

The absolute power of violence that defeats logic and humanity is the manifestation of wealth and power, which are the essence of the US empire: a feudal hierarchy, inflicting countless structural extortions against its people 24/7.

There are many other examples of such events throughout the history of the US empire, which cultivate unspeakable fear among the people while giving the authority blank checks to impose repressive measures. The assassination of a prominent figure can be such an event(1). These and other events are always augmented by disclosures by intelligence agencies confirming that such events can actually take place. These events continue to prevent the subject population from questioning their leap of faith into the destructive system—again, capitalism colonizes our fear of unknown as it establishes itself as God of Money.

Covid-19

It stands to reason that measures appropriate to the risk of the virus should be taken as legitimate medical precautions, just as occasional school closures during a flu season, basic sanitary precautions to avoid getting sick, the protection of vulnerable people, and so on can be considered necessary. But an obvious restructuring of a society in ways which would inflict repressive measures of censorship, banning of free assembly, destruction of communities, restriction of human rights, and creation of lucrative business opportunities for the ruling class should raise serious questions. Especially, as the “new virus” has turned out to be not so new(2) according to scientists, and it also turns out to be not so deadly(3).

As we undergo Covid-19 lockdown measures, the rich and powerful are showered with bailouts, economic opportunities, political decisions to be “rescued”, making billions and billions, while the rest of us endure neoliberal restructuring—losing wages, losing workers’ rights, losing legal rights and losing human rights (4).

The momentum for the Covid measures has been pushed through our society with the same momentum of a protection racket scheme. Just as 9/11 or JFK’s assassination have left numerous undeniable evidence indicating that the events are pivotal in forwarding economic projects, the Covid panic situates itself within the context of a web of financial interests(5). Misinformation and disinformation and crucial evidence indicating conflicts of interests on the part of large international institutions with strong corporate and military ties–the World Economic Forum, WHO, Bill & Melinda Gates Foundation, various prominent NGOs, government agencies, and giant corporate entities—signal to the people that this requires unconditional compliance. Under such circumstances, facts about the virus, inconsistencies, and the rest of the questions become fuel for doubt. The doubt opens the door for the possibility that those who claim to protect you are in fact the perpetrators of the pain and suffering. The people face a catastrophic crisis of their identity: they face a major cognitive dissonance. No amount of facts would convert their positions. In fact, the more they know, the more they become afraid and adamant in sticking to the state-sanctioned Covid rituals.

Germaphobia

Obsessive compulsive behavior manifests to gain a sense of control. It forces physically healthy individuals to engage in ritual cleansing of their body parts and their surroundings, so much so that their actions interfere with their daily lives. The action is purely psychological and ritualistic. Germaphobes are not rational, sanitary or healthy. Just as dirty masks are worn over and over. Just as people wear masks on streets, and immediately take them off as soon as they sit down to eat at an enclosed restaurant.

Logic and reason don’t matter for those who engage in rituals of cleansing in order to escape from facing the ultimate truth about the system and their own positions in it. The ritual behaviors are stipulated by the system —social distancing, wearing masks, no assembly. Obedience and complacency are enforced even if the measures might not be effective in reducing the risk of virus and the detrimental effects of the measures can surpass the supposed lethality of the virus (4), (6), (7), (8), (9) and (10). As their behaviors become habitual in the daily repetitions, the accompanying slogans sink into the psyche of the population. The fear of abuse and pain are pushed under their consciousness as they engage in the rituals. Images of black people getting shot by police officers, whistleblowers mercilessly thrown in prisons, and so on fade as they make sure that their masks are on their faces.

Capitalism preys on the most vulnerable people as the subject population upholds the deadly tendency to protect their own positions in it . Seemingly bright people suddenly acquire a mental block and fail to see the structural mechanism of economic extortion and exclusion as soon as the system turns to them and whispers “what can you do about it?”. Yet, the very presence of the capitalist hierarchy becomes visible as the population shamelessly goes along with flimsy official narratives: “WMDs in Iraq is the biggest threat against humanity”, “inner-city minority kids are super predators who need to be brought to heel” , “the Russians are coming”, or “a deadly plague is here”. Why not? After all, people seem to believe that a country founded by slave owning colonizers with 800 military bases across the globe, which, killing, raping and stealing in a culture of domination, is actually a defender of freedom. The fear of the God of Money is in full motion.

Meanwhile, those who refuse to conform are excluded and shamed. The dynamic is actively encouraged to stay within the corporate political framework, invigorating the illusion of “democracy” dominated by two US imperial political parties. Narratives are prepared by the party establishments. Positions are stipulated. If you are for this selected issue or that issue, or if you are against them, you are drawn into the mudslinging match within a state-sanctioned ring of acceptable ideas. This culminates in a ritual fight called the US Presidential election. Seemingly smart people are cornered into cheering for a gladiator battle between two imperialists who will perpetuate the feudal hierarchy of money and violence. Their scream urging you to vote in order to save the oppressed people is firmly in line with the colonial vestige of manifest destiny. They vote for the very government that kills people in “enemy countries”. They vote for the very government that cages children and incarcerates immigrants. They vote for the government that locks up people who haven’t committed crimes. They vote for the government that kills people for the color of their skin. All those people they claim to save cannot vote. They don’t have to vote because the saviors—American people—will vote to determine their fate. US corporate politics provides some of the main rituals for the God of Money.

Even those dissidents, activists and so on, who are generally insightful and aware have also contracted this condition, attacking their fellow comrades for questioning the lethality of the virus, effectiveness of mask wearing, validity of various lockdown measures and so on for the reasons already described above. However, it should also be noted that those who subscribe to various sorts of fascist ideologies actively align themselves with the restrictive measures of the state as well. For those people, the structural consequences of the capitalist hierarchy and its deceptions do not pose any problem. The momentum of fascism is always useful in eliminating the anti-capitalist and anti-imperialist momentum in times of “crisis”.

The mechanism of conformity and compliance is in place working with a full imperial force 24/7, creating an imperial gravity that lifts those who go along with the establishment, while putting weights on those who don’t. The people are forced to form groups gathered at various levels on the hierarchy, aimed to protect their own existences along with the structural layers of the caste order. Their own values, beliefs and norms are formed to serve themselves but they are built within the capitalist framework. They may oppose those who are above or below but ultimately their worst enemies are those who do not conform to the hierarchy itself. Anti-capitalists and anti-imperialists are often eliminated by the authoritarian momentum within the social networks which must exist within each layer in order to float at the particular position—the imperial gravity permeates throughout the hierarchy at all times.

Pathological conditions have been cultivated among people to cope with the situation: addictive behaviors, obsessive compulsive behaviors, depression, anger, and suicidal ideation. Mental health problems among minors are skyrocketing as well. However, those are not the main concerns of the establishment. Meanwhile, those who refuse to wear masks are openly called psychopaths, just as enslaved people who escaped were said to have a mental illness called drapetomania, or women who could not bear ruthless gender discrimination were said to have hysteria.

Meanwhile, the unconditional authoritarian hierarchy constantly turns minds under the spell of learned helplessness. Some are wrapped up in acute cynicism refusing to consider any possible alternatives. The pain of abuse and neglect force children to internalize abusiveness as a defense mechanism, forcing them to cultivate abusers in their psyche to overcome their traumas, turning them into good candidates for enforcers of pain within the capitalist hierarchy. The God of Money destroys those who defy, while colonizing those who obey at psychological levels.

Organically grown communities that help to connect people harmoniously are forced into the framework of Covid measures to be divided, nullified and assimilated into the capitalist framework. Covid measures alienate people by removing our tools of intimacy, communication, organizing, and etc., while digitizing them into commodifiable data. Those who can afford “the new normal” within their gated communities are blessed with the time to reflect, appreciate art and nature and embrace their fantasy world of a dystopic now, at the expense of the people who are domesticated within the strict measures of structural extortion regimes. Visits to the doctor become online chats based on profit incentives. Education becomes digital indoctrination without the intricacy of sharing and depth of creative pursuit. Small businesses which can foster community values are replaced with global corporations with imperial values. Oppressive measures continue to concentrate among those who are already oppressed. The result of lacking healthcare, weakened immunity, and prevailing health issues manifest as justifications to entangle them with more lockdown measures and financialization of their sufferings.

Capitalism: A Serial Arsonist by Night, A Brave Firefighter by Day

The head of the World Economic Forum, Klaus Schwab, writes(11)

“COVID-19 lockdowns may be gradually easing, but anxiety about the world’s social and economic prospects is only intensifying. There is good reason to worry: a sharp economic downturn has already begun, and we could be facing the worst depression since the 1930s. But, while this outcome is likely, it is not unavoidable. To achieve a better outcome, the world must act jointly and swiftly to revamp all aspects of our societies and economies, from education to social contracts and working conditions. Every country, from the United States to China, must participate, and every industry, from oil and gas to tech, must be transformed. In short, we need a “Great Reset” of capitalism.”

Independent researcher Cory Morningstar writes(12):

“Schwab refers to the COVID-19 crisis as a watershed moment for fourth industrial revolution technologies. And while people are distracted with masks and COVID-positive cases reported incessantly in order to sow anxiety and compliance, the global consolidation of power is happening in real time. In servitude to the power elite, World Economic Forum founder and CEO Klaus Schwab is advancing “a new global architecture”, upheld by a new “global governance”. May 18, 2018: the World Bank partners with the United Nations. June 13, 2019: the World Economic Forum partners with the United Nations. Oct 18, 2019: a high stimulation exercise, modeling a fictional coronavirus pandemic, was held by the Johns Hopkins Center for Health Security, [5] in partnership with the in partnership with the World Economic Forum and the Bill and Melinda Gates Foundation. Approximately five months later, on March 11, 2020: the World Economic Forum partners with the World Health Organization (a UN body) launching the COVID Action Platform, a coalition of 200+ of the world’s most powerful corporations. (By May 6, 2020 this number had swelled to over 1,106.) On this same day, March 11, 2020, the World Health Organization classified COVID-19 as a pandemic.

On March 26, 2020, with 87% of the world’s student population affected by COVID-19 school closures, the Global Education Coalition was announced as a means to accelerate the transition to a global forth industrial revolution digitalized education fueled by emerging markets (SDGs). Founding partnersinclude Microsoft, Google, and Facebook. Other partners include BBC, McKinsey, IBM, the Johns Hopkins Institute for Education Policy, and the Global Business Coalition for Education. [Global Business Coalition for Education Advisory Board Members and Founding Members] This is the global commodification of children, as data commodities, a new class asset. An emerging market, under the guise of SDGs (presided over by the World Economic Forum), built on child data surveillance and human capital assets. [April 15, 2019: From Billions to Trillions: Investing in the Next Generation]”

Winter Oak straightforwardly describes(13) Kaus Schwab’s world view as “fascistic” and describes how Covid-19 can help realize “his great fascist reset”:

“21st century fascism has found different political forms through which to continue its core project of reshaping humanity to suit capitalism through blatantly authoritarian means.

This new fascism is today being advanced in the guise of global governance, biosecurity, the “New Normal”, the “New Deal for Nature” and the “Fourth Industrial Revolution”.

The global capitalist ruling elite have certainly been doing their best to “take advantage of the shock inflicted by the panic”, assuring us all since the very earliest days of the outbreak that, for some unfathomable reason, nothing in our lives could ever be the same again.

Schwab and Malleret are, inevitably, enthusiastic in their use of the New Normal framing, despite their admission that the virus was only ever “mild”.

“It is our defining moment”, they crow. “Many things will change forever”. “A new world will emerge”. “The societal upheaval unleashed by COVID-19 will last for years, and possibly generations”. “Many of us are pondering when things will return to normal. The short response is: never”. (97)”

Historian Luciana Bohne, writes(14) on her facebook wall:

“Ominous words from the World Bank (see beow). They say post-Covid, we’ll have a “different economy.” By “different” they mean “new businesses and sectors.” They mean “the older are being driven to bankruptcy or absorbed into monopolies.” They mean, “You are going to lose your jobs and not many of you will find them in the new sectors because you won’t have the skills.” They blame Covid, but the old economy–that they’re shutting down– well before Covid was in growth ZERO (Germany for example) and most Western-style economies were well below the minimum tolerable 3%. So, Covid didn’t kill it. They drove it to the edge, And now it’s being “restructured,” and “downsized”–it’s NEOLIBERALISM ON STEROIDS. If that is possible, and they think it is.

“In order to reverse this serious setback [Covid] to development progress and poverty reduction, countries will need to prepare for a different economy post-COVID, by allowing capital, labor, skills, and innovation to move into new businesses and sectors.”–World Bank, October 2020 Reportsd”

In the past, we’ve seen the US government engage in destruction of communities by cornering people into destitute poverty, violence, drug epidemic, only to introduce “solutions” which gentrify, incarcerate, murder and steal. We’ve seen western governments engage in destabilization of countries by sanctions, economic embargo, propaganda campaigns and proxy wars, only to declare “so and so must go”, “so and so is killing his own people” and unleash its military might in protecting the western capitalist hegemony. The events surrounding Covid-19 illustrates a text book pattern of events within the capitalist framework in which a concerted momentum of fear, crisis and economic assaults are orchestrated in order to introduce favorable conditions for more exploitation and subjugation.

It must be strongly noted that the urgency of virus measures and their repressive aspects can augment violent strategies against “enemy” in and out of the empire, corporate green schemes against nature, commodification of digitized social relations and financialization of oppressed populations. The human costs as well as environmental costs of plunderings will be enormous. The schemes described by various independent journalists reflect how dangerous those imaginations of domination, which are devoid of material reality, can be.

The active initiatives to replace humanity and nature with an artificial-scape of algorithm, machines, and artificial intelligence are in line with the colonization of humanity and nature by capitalism. Ultimately, digitization of social relations and currency allow the capitalist establishment to put strings on people’s behaviors just as the capitalist hierarchy controls people’s behavior with economic structural extortions (I highly recommend research by Alison McDowell on it below). People’s paths are further atomized and divided without organic social interactions within a rigid framework to be controlled, moderated, and harvested as commodified data. Here are some good materials on the topic and more. Please do look into each materials.

COVID-19 AS A WEAPON. THE CRUSHING OF THE DISPOSABLE WORKING CLASS – BY DESIGN (5)

by Cory Morningstar

Masks Made Mandatory in the Age of Climate Emergency & Planetary Biodiversity Crisis (12)

By Cory Morningstar

Klaus Schwab and His Great Fascist Reset (13)

by Winter Oak

All Roads Lead to Dark Winter (15)

By Whitney Webb & Raul Diego

Introduction to the Fourth Industrial Revolution & The Covid Economic Reset (16)

By Alison McDowell

Episode 383—COVID-911: From Homeland Security to Biosecurity (17)

By James Corbett

“Good Americans”

American people are deeply domesticated people with a grand sense of narcissism as “Americans”. The country has inflicted so much pain and suffering against the world with its colonial policies and wars, yet American people generally perceive themselves as citizens of freedom. Ironically, the more they are cornered into enduring the consequences of their own complacency, the more they cling to the fact that they are at least “Americans”. Because, as it was described above, rejecting their countryhood is a rejection of themselves—the biggest fear of all for the proud Americans.

Such a core value bursts out in the open when we see white people screaming “I’m white!” as they get beaten up by police officers. It’s not that they don’t know the nature of the stratified structure of the caste system when they insist on “diversity“ without dismantling the exploitive system of subjugation. Most of them do know it and they do know their positions in it and they want to keep it that way.

That’s why so many people buy the idea that Russians are messing with their “democracy”. It is not that they actually believe that Russians do stuff to them, but they sense the position of Russia in the imperial framework. “How dare Russians get in the way of the United States of America!”. How ironic is it that those who are going through the economic shock therapy now at the hands of those who inflicted an economic shock therapy against the Russian people after the destruction of USSR fail to see what is happening to themselves. Needless to say, imperial gravity is global. Some western proxy powers, on the other hand, are eager to comply and do extra miles in order to hold better positions in the imperial hierarchy. Neoliberal restructuring of their economies, compliance for military strategic necessities, and demonization of “enemy countries” and so on can be more prominent in those countries than the US itself.

China and Covid-19

Now, I feel compelled to discuss briefly why I think China has acted so drastically to the virus situation since this has been raised over and over to either validate western actions on the virus or to demonize the Chinese government for taking such strict measures.

First of all, it should be noted that there are drastic differences between fully for profit measures implemented by the western countries and measures implemented by China which include considerations for job security, wage compensation, viable treatment options and so on. The measures were effective in keeping the fatality at the very minimum. A recent poll shows the level of of happiness among the Chinese people to be extremely high compared to that of western countries.

China has been cornered by the imperial forces to realize what it sees as a Marxist Leninist society with a long term plan. There have been a few major lessons for China. First, industrialized western powers have attempted to colonize China multiple times. This has necessitated that China have its own industrialization through centralized planning in order to provide for its population while avoiding being exploited and subjugated by the western capitalist framework.

In order to do so, China has established its Five Principles of Peaceful Coexistence: mutual respect for sovereignty and territorial integrity, mutual non-aggression, non-interference in each other’s internal affairs, equality and mutual benefit, and peaceful coexistence. Based on this idea of non-interference, China engages in economic activities with countries that do not share such principles—which include major imperialist powers and proxies.

As a result, China has indeed expanded its economic sphere, successfully pulling countless people out of poverty, while gaining its economic power against the imperial forces. This has attracted criticism among those who see China as an anti-imperial force. “How come China is working with Israel, the US and so on in its economic projects?”, they would ask. The answer to me is in its aim of economic development for its people as well as in its non interference policy. As a sovereign country, China is deciding its own path by weighing a particular balance between pragmatism and moving toward its goal within the world in which imperial powers are dominant.

Now, there is another angle we must pay attention to. The introduction of its market economy for China has been another necessity to avoid destruction of its economy, as well as its nationhood, by development of the black market as well as infiltration by the western colonial interests. By allowing free market activities under the framework of the CPC, China ensures its emerging billionaires to follow Chinese agendas instead of the Western imperial framework.

This background helps us to understand China’s very active position in Covid-19 measures. If indeed what the global economic powers term as the 4th industrial revolution is a determining factor for their future economic powers, not having a stake in it puts China in a secondary position to the Western imperial hegemony. The Covid situation needs to be seen in this dynamic of the economic struggle between the imperialist forces and the rest of the world since it is an introduction to the 4th industrial revolution in many regards.

China simply sees the medical measures against the virus as well as the 4th industrial revolution as a part of the economic phenomenon that needs to be under the guidance of the CPC. This might be hard to swallow for those who recognize the grave danger of further digitizing our social relations under the corporate framework, as well as its financialization and its associated assortments of exploitation and subjugation. This is understandable but such a judgement should not be made according to the western capitalist history and its contexts.

This point has been fully utilized by the western establishment in erroneously labeling China as leading online censorship and repressive measures associated with new technologies. For one thing, regulations against western political infiltration can not be equated to “censorship” or “human rights abuse” when we look at the history of the western colonial destabilization schemes against subject countries. The Chinese government gets more support from its own people than most western governments do for good reasons. The income inequality as well as the poverty rate is lower in China than the US now. Meanwhile, reality shows us that it has been the US police that kills three people on average everyday, and it is the US government interfering with human rights, imposing mass incarceration, violent police forces, institutional discrimination of various sorts, deprivation of social safety nets, and global surveillance and so on against the people. Credit score, racial demography, and tools of oppression have been used to perpetuate exploitation and subjugation in the US for so long.

It just doesn’t make sense to target China when the US is clearly the leading force of exploitation globally, and China to the empire is the biggest obstacle in its path today.

And let’s say that the 4th Industrial Revolution is detrimental to the people in the west. Would it make sense to demonize China and demand that it stop developing AI technology, online capabilities and so on? Isn’t it like destroying all nuclear weapons of Russia and China during the Cold War?

China has its own problems stemming from its introduction of the market economy, environmental issues and so on. Although the structural issues have emerged from reactions against the imperial forces, needless to say, allowing imperial forces to “solve” them totally defeats the purpose. Those problems are not the white man’s burden to be solved by the west. China has its own ways of solving them and it is simply not the business of the imperial west to decide the fate of the Chinese people.

Last but not the least, the imperial forces, including the pre-WW2 imperial Japan, have engaged in bio attacks against China, Korea, Cuba and so on. The US military possesses numerous bio weapon facilities across the globe(18). The preparedness against such attacks is another determining factor in overcoming western imperialism as it is a deterrence against an imperial bio attack. This matter is particularly urgent when the western media, government agencies, corporate entities, NGOs and other political, economic and military forces of the West have been orchestrating various destabilizing projects against China–Uyghur region(19), Hong Kong(20) and blatant lies regarding the Tiananmen Square event(21) to name a few. The empire has been colonizing and co-opting those who defy, and when it fails, it has mercilessly destroyed them.

Understanding these dynamics between China as well as its allies and the Western capitalist hegemony should be a positive step toward our harmonious existence.

Lastly, I would like to sincerely express my gratitude to all of you who stand where imperial gravity is strong. Thank you. Uncovering facts buried in the sea of capitalist propaganda and discerning dynamics rooted in our genuine circumstances and its historical context is important. Because grasping the material reality is a key to remaining human when we are domesticated in the capitalist cage of lies and deceptions.

Hiroyuki Hamada is an artist. He has exhibited widely in gallery and non-commercial settings alike. Hamada was the recipient of a Pollock-Krasner Foundation grant, twice received New York Foundation for the Arts Fellowships in sculpture, and was awarded a Guggenheim Fellowship in 2018. Alongside his work in the studio, his writings have appeared through various online outlets.

*

Note to readers: please click the share buttons above or below. Forward this article to your email lists. Crosspost on your blog site, internet forums. etc.

Notes

1. TalkingStickTV – Jim Douglass – MLK, JFK, RFK and the Unspeakable

https://www.youtube.com/watch?v=UUdqgD6-cLM

2. Some T cells recognize the new coronavirus without having seen it before

https://www.businessinsider.com/coronavirus-preexisting-immune-memory-t-cells-common-colds-2020-8

3. Studies on Covid-19 Lethality

By Swiss Policy Research

https://swprs.org/studies-on-covid-19-lethality/

4. In the Worst of Times, the Billionaire Elite Plunder Working Class America

By Nick Baker

https://www.counterpunch.org/2020/09/03/in-the-worst-of-times-the-billionaire-elite-plunder-working-class-america/

5. COVID-19 AS A WEAPON. THE CRUSHING OF THE DISPOSABLE WORKING CLASS – BY DESIGN

By Cory Morningstar

http://www.wrongkindofgreen.org/2020/04/13/covid-19-as-a-weapon-the-crushing-of-the-disposable-working-class-by-design/

6. MASK WHISTLEBLOWERS TELL ALL

The Highwire

https://thehighwire.com/videos/mask-whistleblowers-tell-all/

7. “Covid-19: the war against the elderly in uncaring “care” homes”

by Patrick Corbett

https://www.patreon.com/posts/patrick-corbett-36665302

8. Fever, Famine and War… and SARS-Cov-2

by Dennis Riches

https://dennisriches.wordpress.com/2020/07/29/fever-famine-and-war-and-sars-cov-2/

9. Perspectives on the Pandemic | The (Undercover) Epicenter Nurse | Episode Nine

https://www.youtube.com/watch?v=UIDsKdeFOmQ

10. Corona Scandal – The Biggest Crime Against Humanity Ever Committed – Dr. Reiner Fuellmich

https://bluecat.live/video/56/corona-scandal—the-biggest-crime-against-humanity-ever-committed

11. Now is the time for a ‘great reset’

By Klaus Schwab

https://www.weforum.org/agenda/2020/06/now-is-the-time-for-a-great-reset/

12. Masks Made Mandatory in the Age of Climate Emergency & Planetary Biodiversity Crisis

By Cory Morningstar

http://www.theartofannihilation.com/mandatory-masks-in-the-age-of-climate-emergency-planetary-biodiversity-crisis/

13. Klaus Schwab and His Great Fascist Reset

By Winter Oak

https://winteroak.org.uk/2020/10/05/klaus-schwab-and-his-great-fascist-reset/

14. Facebook post, October 10 at 8:56pm

By Luciana Bohne

https://www.facebook.com/luciana.bohne.79/posts/203527504625064

15. All Roads Lead to Dark Winter

By Whiteny Webb & Raul Diego

https://www.thelastamericanvagabond.com/all-roads-lead-dark-winter/

16. Introduction to the Fourth Industrial Revolution & The Covid Economic Reset

By Alison McDowell

https://wrenchinthegears.com/2020/07/24/introduction-to-the-fourth-industrial-revolution-the-covid-economic-reset/

17. Episode 383- COVID-911: From Homeland Security to Biosecurity

By James Corbett

https://www.corbettreport.com/covid911/

18. The Pentagon Bio-weapons

By Dilyana Gaytandzhieva

http://dilyana.bg/the-pentagon-bio-weapons/

19. The Biggest Lie About China’s Xinjiang “Internment Camps”

By Tony Cartalucci

https://landdestroyer.blogspot.com/2020/09/the-biggest-lie-about-chinas-xinjiang.html

20. A web of Deceit: Amnesty International in Hong Kong

By Laura Ru

https://medium.com/@italian4hk/a-web-of-deceit-b9b8af234077

21. 30 years after Tiananmen Square, the U.S. is still trying to destabilize China

By Max Parry

Dr. Igor Shepherd’s Talk About the Horrors of a ‘Covid’ Vaccine

By Gary D. Barnett

GaryDBarnett.com

November 17, 2020

Dr. Igor Shepherd is a medical doctor/manager for Wyoming’s State Public Health Department/Preparedness Unit, and is on the Covid response team.

I was able to have a conversation with Dr. Shepherd after he did a talk for “Keep Colorado Free and Open” this past Tuesday. Dr. Shepherd wrote to me, and I was able to get a copy of his important talk. He has taken great risk to do this talk about the horrors of this new ‘Covid-19’ vaccine, so I recommend that all watch and listen. It is a fairly long talk and questions are answered at the end, but it is worth every minute of your time. He calls them “Biological Weapons of Mass Destruction.”

Dr. Shepherd was born and raised in the Soviet Union, and became a Military Doctor in St. Petersburg, Russia, and studied under the Strategic Rocket Force. He is an expert today on bio-weapons, Chemical, Biological, Radiological, Nuclear, and high yield Explosives,(CBRNE) and Pandemic preparedness. His view is that these vaccines are very similar technology to the bio-weapon RND used to develop viral weapons. He fully understands that the plan of depopulation and mandatory vaccinations will be at our doorstep very soon, and is shocked that the American people are so passive concerning this enemy takeover. He believes that this fake pandemic is the means by which a communist global government will be ushered into existence; one that cannot be voted out. I agree with this thinking, as this technocratic takeover and economic destruction will be communistic in nature.

Asia-Pacific trade deal is a big win for China and a blow for US. America First has in fact put America Last on the world stage

16 Nov, 2020 15:48

Get short URL

Asia-Pacific trade deal is a big win for China and a blow for US. America First has in fact put America Last on the world stage

Participants attend ASEAN Foreign Ministers’ meeting ahead of the 34th Association of Southeast Asian Nations (ASEAN) summit in Bangkok on June 22, 2019. © AFP / TANG CHHIN Sothy

96

Follow RT onRT

Tom Fowdy is a British writer and analyst of politics and international relations with a primary focus on East Asia.

The repercussions of the new RCEP free-trade agreement between China and 14 other countries are huge. It creates a massive trading bloc in Asia that America, though its insular policies, will play no part in.

This weekend, 15 Asia-Pacific nations came together to sign the Regional Comprehensive Economic Partnership (RCEP), a mammoth free-trade agreement that has been described as one of the largest in history.

It includes China, Japan, South Korea and members of the Association of Southeast Asian Nations (ASEAN), as well as Australia and New Zealand. The deal solidifies a tariff-free bloc spanning 30 percent of the world’s GDP and 2.6 billion people.

Not surprisingly, its geopolitical ramifications are huge. The mainstream media have been quick to bill it a huge win for Beijing, with China its dominant economy, and at the same time, a loss for the United States. By previously leaving the Trans-Pacific Partnership (TPP), the US now sits on the outside of all major trading agreements within Asia.

As Donald Trump’s tenure in office comes to a close, the RCEP places a clear buffer on his efforts to curtail China’s dominance of global commerce, and also shines a negative light on his strategy of winning more preferential outcomes for the US through tariffs, threats and protectionism, while showing disdain for multilateral free trade.

ALSO ON RT.COM

Quadruple trouble for China? Why Washington’s hopes of creating an anti-Beijing NATO-style bloc in the region is a pipe dream

In contrast, China has responded to the US not by confrontation, but through tactful negotiations to broaden its options. While the deal, of course, amounts to much more than a mere game between the US and China, it is nevertheless a sign of America’s diminishing influence in the region, and Trump’s policies have accelerated that. Joe Biden will be very much left on the outside looking in.

President Trump’s China policy has been an incoherent jumble, where Neo-Cold Warriors such as Mike Pompeo and aggressive protectionists like Peter Navarro have been very prominent.

They all found a common interest in the belief that waging a trade war against China would not only contain its rise and force concessions from Beijing, but in addition bring back jobs and supply chains back to America. The idea of ‘America First’ was a crown jewel of Trump’s presidency and a big selling point to blue collar voters, to the extent that Biden has adopted similar undertones for his coming tenure.

However, this was not just a strategy for China, as it was for the whole world. The administration advocated the belief that multilateral free trade agreements, derided as ‘globalism’, were detrimental to America’s interests – hence the withdrawal from the TPP. And so, the only way forward was to weaponize tariffs to force preferential bilateral agreements on other countries. What was a tool to contain China was erroneously used against everyone, including the European Union, Canada, Japan, Mexico and more. Confrontation was the answer for everything, and left the US devoid of strategic thinking.

When you mix this in with the Cold War sentiment of Mike Pompeo, the situation gets worse. Depicting the world in a binary struggle between “free nations” and “the Chinese Communist Party,” Pompeo believed the administration could subsequently bully other countries into taking anti-China stances, purely on the behest of advancing US interests.

ALSO ON RT.COM

Trump’s ban on investing in Chinese firms shows he’ll keep heat on Beijing until he leaves White House

In the weeks before RCEP was signed and in the run up to the election, the White House made spurious demands to Indonesia, Japan and South Korea to stand up to Beijing, expecting dogmatic ideological commitment, despite providing no incentives. Thus, the accumulation of all these policies set the US up for a fall.

This mix of ‘America First’ and ‘new Cold War’ thinking left the US unable to contemplate the economic interests of many countries and their incentives in economic integration, not least with China itself.

The idea that Beijing could be removed from the global economy and that American trade interests were the only thing which mattered did not compute, and in turn led to a diminishing of US economic influence in the region over a four-year period.

China also responded in a way that was given little attention. Rather than meet hostility with hostility, Beijing has doubled down on diversifying its free trade options and sought to consolidate its position in global commerce. China has established a number of deals in the past few years, including an agreement with the Eurasian Union (Armenia, Belarus, Kazakhstan, Kyrgyzstan and Russia). But the RCEP deal is by far the biggest and the most strategically significant.

Trump’s mistakes mean the RCEP places Biden at an immediate disadvantage when his term as president begins. The US sits outside of both major regional trading agreements. Although the idea of Washington revisiting the TPP has been touted in the media, this is politically untenable. Firstly, following Trump’s withdrawal, the other members renegotiated between themselves and removed US demands they no longer wanted to meet, meaning American re-entry would force the entire agreement to be re-negotiated yet again.

Secondly, the legacy of Trump’s and Biden’s own emphasis on protectionism means the deal remains politically unpopular. ‘America First’ jobs and manufacturing remain the paramount goal.

On this note, it is not surprising that the mainstream media, and many think tank analysts, touted the RCEP as a strategic coup for Beijing. Although the nations of ASEAN should not be removed from the picture, given it was their initiative, the fact is China is now central to the world’s largest trading bloc and thus is able to integrate its markets more deeply with those involved, including a number of US allies.

In contrast, Trump’s term in office has witnessed a series of strategic blunders which have seen Washington deprive itself of a rival alternative. America First put America Last.


COMPOSIT ARTICLES 11-18

Now Is The Time For Americans To Rebel Against Lockdowns, Mask Laws, And Forced Vaccination

by Brandon Smith

(abridged by henrymakow.com)

In April of this year, I published an article titled 'Waves Of Mutilation: Medical Tyranny And The Cashless Society', which outlined a social engineering model put forward by globalists at MIT and the Imperial College of London which I called "wave theory". The model essentially works like this:

Governments must use the pandemic as a rationale for "waves" of restrictive lockdowns, followed by controlled re-openings of the economy and of normal human activity. Globalists claim that this will "slow" the spread of the coronavirus and save lives. However, they also openly admit that these cycles of closures and openings have other uses.

Over time, the citizenry becomes acclimated to governmental intrusion in their everyday lives, and they get used to the idea of bureaucracy telling them what they are not allowed to do when it comes to the simplest activities. The system thus bottlenecks all human interactions to the point that we are constantly asking for permission. We become slaves to the Covid response.

As globalist Gideon Lichfield from MIT stated in his article 'We're Not Going Back To Normal':

"Ultimately, however, I predict that we'll restore the ability to socialize safely by developing more sophisticated ways to identify who is a disease risk and who isn't, and discriminating--legally--against those who are..."

Note that Lichfield suggested that in order to participate in the normal economy you might need to show verification that you have been "vaccinated against the latest virus strains". In other words, the elites expect there to be many more viral events or mutations AFTER Covid 19 has run its course, and the restrictions and controls we see today are meant to continue, possibly FOREVER.

The reality is that the wave model is not a very practical plan for stopping viral spread, but it is a perfect method for conditioning people to submit to a high level of control over their personal lives that they never would have accepted otherwise. The Covid response has also been heralded by elites at the World Economic Forum as a perfect "opportunity" to initiate what they call the "Great Reset". The reset is a plan to deconstruct what's left of the free market capitalist system, introduce carbon controls in the name of the global warming fraud, institute a global cashless monetary system, and finally, move humanity into what they call a "shared economy" in which the average person is no longer allowed to own private property of any kind and is completely dependent on the system for their basic necessities.

THE CASE

1) The Coronavirus Kills Less Than 1% Of The People It Infects

Medical studies in the US indicate that the coronavirus deaths rate for citizens NOT living in nursing homes has been holding well below 1% on average. The largest percentage of deaths by far in the US has been in nursing homes among elderly people with preexisting conditions. People in long term care facilities make up 8% of Covid infection cases but they are 45% of all covid deaths.

Pneumonia alone kills around 50,000 Americans each year according to the CDC, and that's with vaccinations, yet, we are supposed to panic and hand over all our freedoms in the name of stopping a disease that affects a tiny percentage of the population? This is why the media and governments have decided to hyperfocus on infection numbers rather than deaths. The death numbers do not warrant the amount of panic the establishment is trying to foment.

2) Lockdowns Destroy The Economy

It's basic math and finance; the small business sector of the US economy is dying. Small businesses make up around 50% of US employment. The Covid bailout money, handled by international banks like JP Morgan, did not get to the vast majority of small businesses that were supposed to receive it. Those businesses that did get bailouts are still on the verge of closure or bankruptcy. Any further lockdowns will be the final nail in the coffin for the US economy, except for major corporations that are enjoying the lion's share of stimulus cash.

How many lives will be damaged or lost due to poverty and economic collapse if the current trend continues? I suspect far more than any lives lost because of Covid.

Why is no one in the mainstream talking about the most practical solution to the pandemic? The small percentage of people who are most at risk can STAY HOME and take precautions as necessary, while the rest of us get on with our lives. Why are we being ordered to do the exact opposite just to make less than 1% of the population feel safer? How is this logical, reasonable or scientific? The only answer that makes sense is that the lockdown response is about control, not saving lives.

3) State Governors Have No Authority To Take Away Your Civil Liberties, And Neither Does The President

Restrictions based on executive orders have no legal authority under the Constitution. They are color of law, not true law. Laws are debated and passed by state legislatures, not by state governors. Executive orders only apply to state employees and have no bearing on the citizenry.

Leftists and statists argue that during a national crisis the governor has emergency powers and states can do whatever they want. This is false. Under the constitution and the Bill of Rights, state governors do not get to proclaim a national emergency based on their personal opinion and then declare themselves dictators in response. Any "laws" exerted because of such a process are therefore null and void; they are meaningless...

The bottom line is this: State government powers do not supersede the Bill of Rights. Federal government powers do not supersede the Bill of Rights. NO ONE has the legal power to take away your inherent liberties. Those that claim otherwise have something to gain from your enslavement.

4) Mask Laws Are Unscientific

The majority of masks being used by the public today are cloth masks. Not even the CDC recommends the use of cloth masks for their own employees or medical workers. They only recommend N95 masks. They also admit that cloth masks are much less effective at preventing contact with the virus. Yet, the CDC supports the enforcement of cloth masks for the public.

On top of that, some states and countries with the most stringent mask laws continue to see huge spikes in coronavirus infections. For example, New York has been one of the most tyrannical enforcers of mask laws and lockdowns in the US, but in November the state has witnessed extensive infection increases. California, Michigan and Illinois have also seen dramatic infection spikes this month despite hard enforcement of masks. So, where is the science?...

5) Covid Vaccination Is Unnecessary And Potentially Dangerous

Why should people get vaccinated for a virus that over 99% of them will easily survive anyway? Why not simply attain "herd immunity" through natural infection spread and antibodies? The mainstream will continue to ignore these questions because they are inconvenient to the wider agenda.

Also, why should anyone trust a vaccine that was rushed out in less than a year's time? China and the rest of the world spent over a decade trying to develop a vaccine for SARS unsuccessfully, but we are supposed to believe that they created a vaccine for SARS related Covid 19 within months?

The last time the government rushed out a vaccine for a viral epidemic was the 1976 swine flu scare, and that ended with numerous permanently damaged or dead individuals due to faulty vaccines.

As I noted in my article 'Why The Public Should Rebel Against Forced Vaccinations', published in May, there are numerous examples of vaccine tests and implementation going very wrong, from Bill Gates and the World Health Organization giving people polio in various countries through vaccines, to Novartis and their deadly testing of a Bird Flu vaccine on homeless people in Poland, to GlaxoSmithKline and the deaths of children due to their pneumonia vaccine.

Again, it's simply not worth the risk over a virus that over 99% of people will survive. The idea of such risk being forced on the public is completely unacceptable, but many government officials have supported the idea over the past six months. It is important for the public to make it clear now that they will NOT be allowing state or federal governments to make vaccination mandatory.

CONCLUSION: Rebellion Is Needed To Put A Stop To The Fear Machine

In closing, there are endless reasons why we must end the pandemic lockdown agenda once and for all. Most importantly, the lockdowns, mask orders and vaccine plans are a stepping stone to something much worse - Medical tyranny and centralization on an unprecedented scale. I will not personally follow such rules because they are not scientifically or morally sound. They are nonsense designed to frighten the public into complacency and consent.

A rebellion against such measures would be very easy to win. All we have to do is refuse to follow their mandates. What are they going to do? Lock up millions of people? Shoot us? That would sort of defeat the supposed purpose of the very measures they demand we follow. And, if it comes to violence, so be it. I have no problem fighting to defend my freedoms and the freedoms of future generations. Perhaps it is time for conservatives and moderates that stand against the lockdowns to organize for this possible future.

https://www.lewrockwell.com/2020/11/thierry-meyssan/donald-trump-isnt-just-playing-golf-he-is-purging-the-pentagon/

Donald Trump Isn’t Just Playing Golf, He Is Purging the Pentagon

By Thierry Meyssan

Voltairenet.org

November 18, 2020

In the midst of the presidential election results, President Donald Trump undertook to purge the Pentagon of the rebel leaders. The first target was the Secretary of Defense, who kept lying to hide the real objectives of the general officers.

Once the presidential election is over, the tenant of the White House has only the right to manage the day-to-day business. But just before the Federal Election Commission announced the results of the election, President Donald Trump began an unprecedented cleanup of the Pentagon.

The U.S. press, always busy portraying him as an incompetent narcissist, does not seem to think this is important. It presents him as playing golf.

However, he dismissed:

- Secretary of Defense Mark Esper (replaced by Christopher Miller);

- his chief of staff, Jen Stewart (replaced by Kash Patel);

- the Director of Defense Policy, James Anderson (replaced by Anthony Tata);

- Under Secretary of Defense for Intelligence and Security Joseph Kernan (replaced by Ezra Cohen-Watnick); and

- Nato Liaison Officer Michael Ryan (replaced by Andrew Winternitz)

This movement of personnel is easy to interpret: since the announcement by the major media of an undivided victory of Joe Biden, the confessions of high-ranking civil servants recounting the way they sabotaged years of Jacksonian politics have multiplied [1] The ousted officials are suspected of covering them and even plotting to overthrow President Trump. On the contrary, the senior officials promoted are loyal to the current president and all share the conviction of close ties between the Clinton and Obama presidencies and the Muslim Brotherhood.

It may seem far-fetched to talk about a foreign secret society in connection with the US presidential election. This is not the case, however.

Kash Patel would have pushed this reshuffle. Former assistant to Devin Nunes’ representative on the Intelligence Committee, he had played a role in demonstrating the surveillance of Donald Trump by the Obama administration and in Russiagate’s ineptitude [2]. He was then appointed Deputy Assistant to President Trump and Director of Counterterrorism at the National Security Council. Of Indian origin, he knows the role of the Muslim Brotherhood in the organization of Islamist attacks.

The new Secretary of Defense is the former director of the Counterterrorism Center, Colonel Christopher Miller. One can therefore assume that he has a thorough knowledge of the Muslim Brotherhood nebula.

The new Director of Defence Policy is Brigadier General Anthony Tata. A former commentator for Fox News, he has several times accused President Obama and the Clintons of being the chief terrorists of jihadist networks. Carried away by his momentum, he also accused the former director of the CIA, John O. Brennan, of having hatched an assassination attempt on President Trump, which turned out to be defamatory (but not the first claim). He will be assisted by Thomas Williams, a former member of the National Security Council who was trained by Zbigniew Brzezinski.

The new Under Secretary of Defense for Intelligence and Security is Ezra Cohen-Watnick. He is a former member of General Michael Flynn’s Military Intelligence team that fought against the Muslim Brotherhood in the field. He has a reputation for refusing political compromises.

The new head of Europe and NATO is Andrew Winternitz. This Japanese political scientist has already been in charge of France at the Pentagon for several years. He is the only member of the new team who has not had to fight against the Brotherhood.

This upheaval came very late: for four years, Pentagon officials did everything they could to avoid applying President Trump’s instructions and prolong the conflicts. Trump had given them a great deal of leeway, which allowed them to act in other areas without fear of a military coup d’état. In recent months, however, the general officers have increasingly shown their willingness to use the health crisis to keep all politicians, including President Trump, out of the public arena; an attitude in total contradiction to the troops’ support for the Jacksonian president.

Clearly, the positions of the various parties vis-à-vis the Muslim Brotherhood were a criterion for this reshuffle. Given the close ties of the Obama (President Barack and his half-brother Abon’go Malik) and Clinton (President Bill and Secretary of State Hillary) families to the Brotherhood [3], everything suggests that these events are linked to the current institutional crisis in the United States….

https://www.armstrongeconomics.com/international-news/china/why-china-will-become-1-world-economy/

91

Blog/China

Posted Nov 18, 2020 by Martin Armstrong

QUESTION: I believe you have said that in order for the Chinese to become the next superpower and be the monetary capital of the world the rule of law would have to exist. Given the recent take down of Alibaba how can one have faith in a system governed by a communist hierarchy?

TW

ANSWER: Between now and about 2037, a lot is going to happen. Many questions have come in and argued that I have to be wrong about China, for they are a Communist government. They are not communists, for people are allowed to own property and create companies. China was totally different from communism from Russia. Stalin was paranoid after a counter-revolution because he was suppressing the people hard. China had the tall-poppy syndrome. As long as you keep your head down, it was not cut off. Stalin had people killed because they were smart. This is why China boomed after 1989 because they did not terrorize humanity like the Russians. In East Germany, children were told if their parents spoke ill of the government to report them. It was the classic divide and conquer even within families.

What people seem to misunderstand about this forecast is thinking that China will just boom. That is not the case. This Great Reset is the self-destruction of Western society. We have already witnessed the most drastic decline in GDP than any economic recession or Great Depression including that of the 1930s. World GDP may shrink by more than 50% by 2022. That means that China does not have to boom, all they need do is decline less than that of the west.

Vaccines--Too Little, Too Late?

November 18, 2020

Trust in institutions, authorities and Big Pharma is scraping the bottom of the barrel, and rushing these vaccines into mass use with extremely high expectations of efficacy is setting up the potential for a devastating loss of trust in the vaccines should they fail to live up to the claims of 100% safety and 95% effectiveness.

We're being assured by Pfizer and Moderna that their Covid vaccines are 95% effective and are safe enough to be injected into hundreds of millions of people. Before accepting these extremely consequential claims, let's look at the actual testing process and results.

In the Pfizer trial, half of the 44,000 volunteers received the vaccine and the other half got a placebo shot. Then the researchers waited around to see how many of the volunteers randomly came down with Covid. Pfizer reported that out of 170 cases of Covid, 162 were in the placebo group and eight were in the vaccine group.

So a total of 0.386% of the 44,000 volunteers came down with Covid by means unknown, and this tiny sample is the foundation of grandiose claims of 95% effectiveness? Note the incredibly small sample size. If even 3% of the test group had contracted Covid, the sample size would be 1,320 people--still a small number but considerably more persuasive than 1/3rd of 1% (170).

These results tell us very little about what we really need to know. Allow me to propose a test protocol that would tell us what we need to know.

Take 100 politicians, authorities and Big Pharma executives, give them two doses of vaccine and then have them serve 4-hour shifts in a crowded ward of severely ill Covid patients for a week, without any masks or protective gear. In other words, expose them to sustained, intimate contact with patients with severe cases of Covid, spending hours every day in a soup of virus.

If 100 people took the measles vaccine, would they hesitate to expose themselves to measles patients? No, because the measles vaccine is close to 100% effective. If the politicians and Big Pharma executives refused to participate in this trial, that would tell us all we really need to know about the effectiveness of their Covid vaccine.

But the trial isn't finished--not by a long shot. We need to know if the vaccinated people can still transmit the virus to unvaccinated people. So at the end of their shift, the 100 politicians, authorities and Big Pharma execs clean up and then crowd into a poorly ventilated bar with 100 unvaccinated volunteers, singing, dancing and breathing the same fetid air for two hours every night.

Next, repeat this trial protocol with another 100 people, 50 of whom have chronic conditions such as hypertension, metabolic disorders or COPD, and 50 who are 65 years of age or older. The only way we'll really know if the vaccine is effective for at-risk people is to do a rigorous test like this.

Third, repeat the trial protocol with 100 people who have autoimmune disorders or family histories of autoimmune disorders. There is no other way to discover the potentially harmful consequences of the vaccine on those with a propensity for autoimmune disorders other than a rigorous test of the vaccine, i.e. sustained exposure to the virus over extended periods of time.

Lastly, monitor all the volunteers daily for six months for any side effects of the vaccine. It will take years to really know what side effects may manifest, but six months would at least establish a baseline of safety.

The results of these trials would tell us what we absolutely need to know before we blindly inject tens of millions of people with these vaccines:

1. Will the vaccine offer rock-solid protection against sustained exposure to the virus?

2. Can vaccinated people transmit the virus to unvaccinated people?

3. Will the vaccine protect at-risk people without causing any adverse effects in the most vulnerable groups, including those with autoimmune disorders?

Let's also be aware of the limits of any vaccine, even one that's 95% effective. No vaccine will stop the rapid advance of the virus in the next few months, nor will it stop America's healthcare system from unraveling: U.S. Healthcare Is Unraveling (November 17, 2020).

The virus won't stop health care personnel from burning out and becoming too exhausted to go to work.

Nor will it make all the post-Covid symptoms of those who came down with acute Covid go away. These conditions will demand extended care on an unprecedented scale.

Let's also ponder the potential effects on public trust should the vaccine fail to live up to its advertised effectiveness (95%), or some of those who get the vaccine come down with severe side-effects, or suffer the misfortune of dying from unknown causes.

Trust in institutions, authorities and Big Pharma is scraping the bottom of the barrel, and rushing these vaccines into mass use with extremely high expectations of efficacy is setting up the potential for a devastating loss of trust in the vaccines should they fail to live up to the claims of 100% safety and 95% effectiveness.

95% effectiveness sounds good, but 5% of 300 million Americans is still 15 million people. Toss in the potential for side-effects and there's still a roulette wheel spinning that every individual will have to consider. Behaviors will not time-travel back to 2019, even with a 95% effective vaccine.

A great many people will decline the vaccine until they see how the first wave of volunteers fare. Another consequential number will refuse the vaccine for any one of numerous reasons. A third group will put it off because doubts remain: maybe a new vaccine will be even better.

The vaccines are too little, too late: too little is known about their mass effectiveness and eventual side effects, and it's too late to affect the current advance of the virus, the long-term consequences of those with post-Covid conditions or reverse time to the era before behaviors changed.

Is This Virus the Weapon Being Used to Usher in a Communistic Takeover of the United States?

By Gary D. Barnett

November 18, 2020

“I dare hope that all the peoples who have lived through communism will understand that communism is to blame for the bitter pages of their history.”

~ Aleksandr Solzhenitsyn–Source: www.independent.co.uk

There has been much talk over the years, and many have claimed that communism is dead. Communism never died, and in fact has continued to expand, especially in the West. No war, and no fight were necessary, just a failing economy and a country weakened and destroyed from within. That is exactly what is happening today, and now we face the horrors of communism and the end of Western civilization. It is imperative to remember that all roads toward socialism lead directly to communism, as Lenin so described. In the United States, the march toward socialism has been steadily advancing for many years, especially in all the so-called ‘halls of learning,’ and in the government that supports this transition. The goal of the state will always be toward socialism, because that is the system that allows for the few to control the many. The takeover of the economy and the elimination of private property will signal the end of freedom and the advancement of communism.

In this day and age, with such colossal technological ‘progress,’ the controlling system coming will certainly be technocratic in nature, but the underlying structure will still be one where the masses or proletariat, will be controlled by the few in what will be a pure communistic society. The fraudulent ‘pandemic’ is simply the tool being used to advance these reset agendas, and this is being accomplished due to weakness and fear by the people at large. It does not have to be this way, but when the masses voluntarily accept their own servitude, blame cannot be placed just on the evildoers in control, but should be placed at the feet of the people themselves. Evil lives in every man, and in order to defeat it, one must first understand his own evil, and fight to suppress it. This takes much courage, and truth has to not only be sought, but also accepted. If this does not happen throughout society, freedom and the joy of life will not endure.

If this sounds dark and ominous, that is because it is just that. We are at the crossroads of hell, and very few have any understanding of this fact. Communism has been blamed for the most deaths of the innocent in human history, and this is for good reason. But Americans have little if any understanding of the scope of this phenomenon, and certainly do not understand that their own country’s ruling class has been a major part of this most heinous and abhorrent cancer on mankind. It has not been just Marx, Lennin, Stalin, Mao, and Pol Pot that have perpetrated atrocities and unholy massacres. It has not been only Russia, China, North Korea, and others that are responsible for all the carnage over the past century and a half. Western powers, especially the United States, have been involved in and supportive of many communist countries and leaders. Russia and China were heavily supported by the United States and its banking and corporate systems during these dark periods, as were Stalin and Mao and many other dictators and murderers. What stands out about communistic and dictatorial regimes, is that those seeking power and control all understand that socialistic and communistic policies will gain them what they seek, which is total power and control over all of society. So whether they participate directly or by stealth when supporting communism matters not, as all those that desire control will eventually attempt to gain submission through socialistic means. This could happen through support and funding of monsters, aggressive wars, active assistance for regime change policies, and other practices meant to advance totalitarian rule, all done in the past by the United States government and its controlling ‘elites.’

I have recently been corresponding with Dr. Igor Shepherd, a gentleman that has seen both sides of this monster called communism. He is Russian, but living and working in the United States, and fully understands that this long-planned global takeover being called “The Great Reset,’” is most definitely a communistic plot. I agree with this assessment, as this country and other governments around the world as well, are aggressively seeking the major tenets of communism, and the Western powers are leading the way. Dr. Shepherd gave a powerful talk recently about these matters and more. It is invaluable information.

Most everything being told to the American citizens are nothing more than lies, deceit, and propaganda. There is no pandemic, but there is a plot to take over the entire country, destroying any and all normal aspects of life. The destruction of the human spirit and psyche is happening before our eyes, and many of the things planned by the controlling class will cause the annihilation of this economic system and the loss of freedom. The agenda to gain control over the people is moving forward at lightening speed, and this looks to be the final push toward achieving a communistic style society with the controlling interests dominating the very minds of its subjects.

In my opinion, the most important part of this nefarious conspiracy will rely on mass vaccination. The coming Covid vaccine has most likely been available and has been stockpiled for a very long time. It is not meant to prevent or cure any so-called virus or disease, but will be used to take over the minds and bodies of men. All the technology to do this is in place, and the incentive for the worst among us to enslave the population is evident. This is not even being done in secret, as the plans of the chosen masters have been openly discussed and announced for any that choose to listen. Injecting everyone with this new vaccine is in the works, and has been for a long period of time, and is most definitely a fascist partnership between the U.S. government, the world’s ‘health’ organizations, Bill Gates and his criminal foundation, and the pharmaceutical industry.

This is the big push toward changing the entire world from one of freedom and hope to one of total despair. Mass disobedience is necessary, and readiness to defend from tyranny at any cost is crucial. Gather together, seek out like thinkers, disobey every order, dissent on every level, and stop this onslaught of deadly and murderous communism. A mass uprising is needed now!

As Clock Ticks On Election Certifications, Here’s Where Trump Legal Challenges Stand As Joe Biden continues to claiming victory (something he said he wouldn’t do until the election was independently certified), various legal challenges brought by President Trump, the GOP, and allegedly disenfranchised voters are working their way through the courts.

And unless the courts intervene – up to and including the US Supreme Court – the clock is running out on Trump’s ability to claim victory in light of alleged fraud, as several states move to certify their results.

While Georgia is set to certify its election results on Friday, Nevada, Michigan and Pennsylvania are expected to follow next week. Arizona, meanwhile, has until Nov. 30, and Wisconsin until Dec. 1, according to Bloomberg.

States make their election results official through a certification after what’s known as a canvass to account for every ballot cast and to confirm that every valid vote was counted, according to the U.S. Election Assistance Commission. Procedures and deadlines for certifying votes vary by state.

Certified totals can change if a state allows recounts after certification, which Georgia, Michigan and Nevada do, or if there is a challenge to the election. But certification amounts to a declaration of a winner, and the winning candidate will assume office unless a court intervenes, said Michael Morley, an assistant law professor at Florida State University who’s worked on election emergencies and post-election litigation. –Bloomberg

“This is going to be a series of dominoes that fall sort of ineluctably toward the conclusion that we already know is true, which is that Biden is the winner of these states and is the president-elect,” said NYU law professor, Richard Pildes, adding: “This will be the formal legal step that cements that.”

READ ALSO In The Biggest App Store Overhaul Since 2008, Apple Cuts Fees For Most Developers By 15%

As JPMorgan’s Michael Cembalest notes, however, the US Supreme Court could hear appeals on state challenges, “such as late-arriving absentee ballots in PA (too few to change the outcome); complaints on transparency of vote counting (judicial relief could entail recounting certain counties); illegal acceptance of certain votes (votes in question too small to change the results); and complaints that the voting process suffered from pervasive irregularity and fraud (most of these claims have been rejected by lower courts over the last 2 weeks).”

Cembalest concludes that “a LOT of very unorthodox things have to happen for Trump to be re-elected,” adding that “Based on the uncertified vote results, Trump would have to reverse or impede results in three states to prevent Biden from reaching 270 electoral votes.“

That said, he’s not ruling anything out.

Here’s where things stand with state challenges:

In Pennsylvania, the Trump campaign continues to seek to block the certification of the results in the state over alleged unfair voting practices in which Democratic-leaning areas were given greater opportunities to correct mistakes on their ballots. A federal suit seeks to challenge over 680,000 mail-in ballots which were counted without proper oversight from GOP poll watchers – who say they weren’t allowed within 20 feet of election counters.

Trump’s campaign has also accused election officials of violating a judge’s order to allow meaningful access to watchers – at minimum six feet – as long as they adhered to measures implemented to reduce the spread of covid-19.

Another challenge seeks to disqualify ballots received after election day – which would affect an estimated 10,000 votes, or not enough to overcome Biden’s more than 70,000 vote lead over President Trump.

READ ALSO Why inflation could be on the way back

In Michigan, where Biden is ahead by approximately 150,000 votes, the Trump campaign is seeking to block certification of results in Wayne County – where the Board of Canvassers just overcame a major controversy in which two Republican members of the four-person body refused to certify the results of the election, only to reverse course three hours later and bend the knee.

State elections officials will meet on November 23 to confirm the final election results.

Nevada – also projected to go to Biden by a margin of more than 30,000 votes – has been served with a lawsuit as well, asking that Trump be named the winner or that the results be void with no winner declared and certified. Trump’s team claims that “fraud and abuse renders the purported results of the Nevada election illegitimate,” and alleges that 15,000 people living out of state illegally voted.

In Georgia, a lawsuit was filed in Chatham County alleging ballot processing issues, while GOP party Chairman David Shafer tweeted that observers saw a woman “mix over 50 ballots into the stack of uncounted absentee ballots.” The lawsuit was dismissed on November 5.

And in Arizona, the Trump campaign filed a lawsuit on November 7 claiming that legal votes were rejected based on poll watcher affidavits claiming that they had issues with voting machines.

THE HUNGER GAME HAS BEGUN: THE ELITE HAVE BEGUN THEIR FULL SCALE EXECUTION AND DECIMATION OF THE MIDDLE CLASS!

Jack Metir Uncategorized November 16, 2020 8 Minutes

The coronavirus is disrupting food supply chains because farmers and laborers cannot work or travel, transportation delays are causing shortages, and in the United States, for example, meat processing plants have been forced to close.

Not only are these breaks in the supply chain affecting the availability of food, but also its affordability. Millions who already struggled to support themselves and their families have been struck by economic hardship caused by lockdowns around the globe.

Millions people will be pushed into extreme poverty this year owing to the pandemic, but the long-term effects will be even worse, as poor nutrition in childhood causes lifelong suffering. Already, one in five children around the world are stunted in their growth by the age of five, and millions more are likely to suffer the same fate if poverty rates soar.

Throughout history, mankind has waged a constant war with starvation. From the time of the first hunter-gatherers, through the early cultivation of crops and all the way to our modern, industrialized farming techniques, we humans have been working to ensure that we can survive the next winter, when no crops are growing and animals hide in their burrows. To our ancestors, this was a great challenge, unlike today. For that reason, the idea of being a “prepper” would seem strange, as they all lived a prepping lifestyle.

The truth is we have never been more disconnected from life, from the world, from the soil, from the trees, and from our own souls.

We are straying away from our roots on a dangerous road from which there will be no turning back. And the good and bad news is that we are the last generation that can truly do something about it.

We no longer know how to live without refrigerators, without cars, without phones or without supermarkets.

What will you do tomorrow if you simply are unable to buy things?

In this short Video, I will unearth a long-forgotten secret that helped our ancestors survive famines, wars, economic crises, diseases, droughts, and anything else life threw at them… a secret that will help you do the same for your loved ones when America crumbles into the ground.

Yet somehow, modern western culture has distanced itself from the reality of needing to grow food. As the number of farmers in our midst keeps dwindling and industrialized farming takes over, fewer and fewer people have any idea of where their food comes from. The idea that the grocery store produces meat and vegetables rather than farmers and ranchers growing it, might make for a good joke, but the ignorance behind it is outright frightening.

The United States is the number one food producing nation in the world; yet we do it with a very small percentage of our overall population. Farming, fishing, forestry and related activities account for only 1.8% of the overall workforce. Those people not only produce the food that we eat here at home, but much that is exported overseas.

We depend on this small portion of our population, plus the others who work in the food service industry, to keep the rest of us fed. The rest of us don’t even bother thinking about it. After all, there’s always food in the grocery store… lots of food. There always has been and there always will be, right?

But what if they can’t? Since coronavirus lockdown has started, the farmers in this country can’t produce the food needed to feed our population, let alone all the other countries in the world that buy $159 billion in American food products. What will we do Next?

Main drivers of acute food insecurity found all over the continent include:

Conflict/Insecurity

Examples: Interstate conflicts, internal violence, regional/global instability, or political crises.

In many instances, these result in people being displaced as refugees.

Weather extremes

Examples: Droughts and floods

Economic shocks

Macroeconomic examples: Hyperinflation and currency depreciation

Microeconomic examples: Rising food prices, reduced purchasing power

Pests

Examples: Desert locusts, armyworms

Health shocks

Examples: Disease outbreaks as (COVID-19), which can be worsened by poor quality of water, sanitation, or air

Displacement

A major side-effect of conflict, food insecurity, and weather shocks.

We’re Not Hearing About It

Should there be actual shortages of food, there would be a need for some sort of food rationing. That would be a function of the USDA (US Department of Agriculture), who would be responsible for putting some sorts of controls in place, ensuring that the food which our farmers are producing would be properly allocated, so that everyone’s needs would be met.

What’s scarier than the potential of food shortages in the near future, is that we’re not hearing about it. Nor does it seem that the USDA is hearing anything about it. Nothing is being done to prepare for potential shortages, because the people who should be dealing with that don’t have any idea of what is going on. They seem to be kept in the dark and nobody seems to know who is hiding that news.

This means that when the food shortages begin to manifest, nobody is going to be ready for it. Government bureaucrats and major producers up and down the line will be caught with a sudden need to do something, but without the time to plan out what should be done.

Can The Food Run Short?

There are places in the world today where food shortages are the norm. I’ve had church pastors from other countries in my home, who have told me about the people they bury, even children, because they’ve starved to death. This is a very real problem in a number of different countries. It’s not something made up by non-profit organizations, to try and get your money.

Are we going to run into that problem here in the USA? We could, but we probably won’t. As a country, we produce something like 180 billion tons of food per year. Of that, about a third actually goes to waste, not ending up on anyone’s dining room table.

The reason for this waste, is that, as a country, we are very focused on the appearance of our food. That began just after the time of World War II, coinciding with electric refrigerators becoming commonplace. Even with their faults, those early electric refrigerators were so much more efficient than iceboxes, that it made a difference in how our food looked, especially produce. No longer did homemakers have to concern themselves with brown spots on produce; it would be consumed before that happened.

With that being the case, homemakers became more selective in their purchases, passing over imperfect produce, in favor of better looking specimens. Noticing this, grocers stopped putting less than perfect produce on the shelves, opting to throw it away and make their selection look better. This then worked its way back to the farm, so that now there’s a lot of food which goes from the farm right to the landfill, rather than trucking it to the store.

Please note that there is nothing wrong with all this food that gets thrown away. In most cases, the flaws are superficial, mere cosmetic blemishes. I’m not talking about food that has spoiled, just food that doesn’t’ look so good.

With so much food that doesn’t ever get eaten, our farms would have to suffer severe shortages, before it became a shortage in the grocery store. The ones who would most likely be affected by such shortages would be our overseas customers, who buy some $160 billion worth of American food per year.

When Food Runs Short

This isn’t to say that it would be impossible for there to be serious food shortages in our country. The amount of food our farmers produce annually is dependent on a lot of separate factors. Should just one of those factors fall short, we might suddenly find ourselves in the position where productivity on the farms is drastically reduced.

There are a number of things I can think of, off hand, which could bring that about, ranging from severe weather to government regulation. Some of these regulations are being pushed for in Washington, without anyone taking into account the ultimate effect of those regulations.

Should the food supply begin to run short, we would first see it as a rise in prices at the store. The only effect that would have on most of us is a more costly grocery bill. We’d pay it and complain, tightening our belts elsewhere in our budgets, so that we could buy the same as we’ve always done.

But there would be those who couldn’t afford to spend more on their grocery bills; those people would suffer. Oh, they wouldn’t starve, but they would need to change their eating habits, so that they didn’t. More than anything, rather than buying fresh, they would have to settle for less favorable choices, perhaps even eating the food that is currently being thrown away.

It Could All Stop Tomorrow

While it would take a lot to shut down our farms or lower the amount they produce to levels where we would see shortages, there is one thing that could shut down food supplies in a day. That’s any sort of damage to our nation’s trucking industry.

The food production and food service industries depend on trucking, more so than many other industries. Without our nation’s trucking industry taking food from the farm to the various processing facilities and then from those to the stores, the supermarket shelves would empty in a day.

As I sit here writing this, that’s happening in Wyoming. Severe winter weather has made the roads all but impassible, with over 200 miles of Interstate 80 closed down. This is making it difficult for truckers to make their deliveries, which in turn has led to empty shelves in the stores. Should this situation last for more than a few days, things could get serious for the inhabitants of that state.

The same could happen nationwide, should the electrical grid go down or some sort of nationwide quarantine be put in place due to pandemic. It wouldn’t matter what farmers could produce then, as it would only be available to people living locally. Those who lived in states where there wasn’t any food grown or even in cities that were far from the farms and processing plants, had better have their pantries stocked, or they’ll find themselves on very short rations.

In this short VIDEO, I will unearth A lost super-food will bulletproof you against any food shortage or famine. It’s a food that vanished with the Incas over 6 centuries ago

In the next crisis these lost skills will be more valuable than gold, food supplies and survival equipment combined. These skills have been tested and proven to work for centuries.

Here is just a small glimpse of what you’ll find in this massive 300-page sequel (in color) to The Lost Ways:

A lost super-food will bulletproof you against any food shortage or famine. It’s a food that vanished with the Incas over 6 centuries ago. This mysterious dish was just recently rediscovered by NASA who has been giving away rations of it to our brave men and women in their month-long space missions. The Incas stored it in pit holes for up to 10 years, ate it year-round, and actually used it to survive a 4 year long super-drought that wiped out their southern neighbors. So, if it managed to save the Incas centuries ago and it still works for our astronauts today, you can bet your last dollar it will keep you and your family well fed in any crisis. And the best part is that you probably already have the ingredients in your kitchen right now.