Course Summary

This course is aimed at both molecular biology and bioinformatics graduate students -- it will work best balanced between MCD/Biochem grads and bioinformatics grads. (Postdocs and faculty are welcome to sit in or audit)

No programming background is required. If you think you might need to analyze RNA-seq data sets in your grad career, and/or want to understand how to find new RNA-based regulatory elements in genomes & transcriptomes, this is the course for you. We will make heavy use of the UCSC genome browser to interpret complex expression data.  The course includes lectures, scientific literature discussion, problem-solving assignments, and a final gene-discovery or RNA-seq analysis project.


Homework Assignments

  • Assignment #3: Making your own covariance model I've posted a much more detailed description of the assignment here, with what needs to be turned in. Due Friday, Nov. 4, but extension available if needed.  This is ...
    Posted Oct 28, 2011, 2:19 PM by Todd Lowe
  • In class RNAz exercises Determine if the following are classified as "RNA" or "other" by RNAz and if it has the approximate correct structure (and by looking at structure in Rfam, if the RNAz ...
    Posted Oct 27, 2011, 1:57 PM by Todd Lowe
  • In-class exercise: RNA Gene Search, Alignment & Discovery Using these sequences, decide if they are RNA, protein-coding, or "other" genomic regions.Tools to use:BLASTRfamRNAzIf time, cmbuild, cmalign, cmsearch:>Mystery-seq1gccccctggcgtggggcgtcgaggcgccgccacggccgctgtgaaaacgccccctccaaggggcgc>Mystery-seq2 ...
    Posted Oct 20, 2011, 2:52 PM by Todd Lowe
  • Homework #2 - Due Fri, October 7th (1) Archaeal genomes.  Complete the team exercise started in class to identify both missed protein coding genes (using the Table Browser intersection between RefSeq track and Pfam/Conserved Protein Domains ...
    Posted Sep 30, 2011, 1:40 PM by Todd Lowe
  • Assignment #1 - Due Friday, September 30 For the first assignment, I'd like everyone to get familiar with the UCSC Genome Browser.Please go to the video/powerpoint tutorials for the vertebrate genome browser produced by ...
    Posted Sep 24, 2011, 10:03 PM by Todd Lowe
Showing posts 1 - 5 of 5. View more »