TAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTA*ccttaaagaa
The last 24 nucleotides of helix 45 are in italics, followed by the 13 nucleotide “tail” (underlined). The anti-Shine-Dalgarno sequence CCTCCT is underlined and in bold. The terminal 3’ “A” residue is indicated with an asterisk. The 10 genomic nucleotides following the end of the tail are shown in lower case.
Re-annotation increases the number of known anti-Shine-Dalgarno sequences from 8069 to 20,495. We analyzed ~121,000 prokaryotic 16S rRNA sequences, representing 34,439 unique prokaryotic taxids. Of these, 8,069 taxids were already annotated such that the 16S rRNA contained an anti-Shine-Dalgarno sequence. We were able to re-annotate a further 12,426 taxids, extending the annotation of the 3’ end of the 16S rRNA, so that the newly-annotated 16S rRNA did contain a perfect consensus antiSD, CCUCCU. This increases the number of known antiSD sequences from 8069 to 20,495. There were a further 13,791 taxids that could not be re-annotated (see Methods), and 24 where key sequence information was missing or ambiguous, and finally there were 128 taxids where 16S rRNAs convincingly lacked a consensus antiSD. 19 of these had a close variant of the consensus antiSD, while 109 had a more distant variant or appeared to completely lack an antiSD. These results are summarized in the following table: