Trinity

posted Feb 28, 2012, 12:11 PM by Jerry Johnson
I am having a problem with Trinity, I think I am doing everything right.
I have a single end read RNA seq library in FASTQ format, which I ran through the FASTQ groomer.
When I try to run Trinity on the groomed data set, I get the following in the log:

Error, cannot find meryl at /soft/trinityrnaseq/20110820/bin/trinity-plugins/kmer/meryl/meryl at /soft/trinityrnaseq/20110820/bin/Trinity.pl line 194.


And there is no data in the Assembled transcript.
It looks to me like the program can't find the place it needs to run, but I could also be missing a setting.


Thanks for any help,

Jerry

Settings:
Data is single end,
Strand specific library is F or none (neither work)
No additional parameters

Here are the first few lines of the groomed FASTQ file:

@HWI-EAS432:5:1:1:264#0/1 TGACGGAGTTGACTNCCGGGGTATCTAATCCAGTTTGCGACCTACTCTCTCATCCCTCAGTGTCATATTATCGTA +HWI-EAS432:5:1:1:264#0/1 A=@CC>?B<@ABB:%<C@>9@13=CBBBBCBBB7BB2@;>ABA;>BBBBABBBBBB?=%3476??>???=?=399 @HWI-EAS432:5:1:1:769#0/1 TCTCCTCTCTTTCACGTTTCCGATTCGGCCGATCAATGGACGGCTTCACAGATCGGAAGAGAGGGTCAGGAGGAA +HWI-EAS432:5:1:1:769#0/1 ?;?@9?>BBBBBBB@6>BB<@1=AA?<>A@?;674?:729;;=<=='3;;7:1359/5/9/(67(0'0*%-/5,4 @HWI-EAS432:5:1:1:42#0/1 TCTCTCGGGAGCTCTTCGTCGAGGTGGAGTGGTAGACATGTACGGCTTCTTCCCCCCCCCCAAACCGGAGCCAAC +HWI-EAS432:5:1:1:42#0/1 ?B@B<B79@?<B6AA:A<<>1>??1=-:91777<7:B?8.9=;'5>7:769/9:*;='7&83;;((-0..,1-*( @HWI-EAS432:5:1:1:1924#0/1 CTGGATTCTGAAACATTTCTCTCATTTGGGTATTTGATTCCATCATGTTACGTACATTCGGGTTCATGTTGAGCA .
.
.


Comments