QIC InputUse the New post" button below to write your questions or comments.
If you are requesting support please describe the type of support needed or the issue you are experiencing.
Make sure you save and publish your post.
This page is monitored by Galaxy U of M team members.
Responses from the team will be posted on this web page as comments to the post in question.
New Post ButtonDifficulty seeing the "New Post" button next to the RSS wave icon on the Help/QIC page? Try this:
Make sure you are logged in in your UMN GoogleApps account before you access the help page. You may be asked to sign in again. Do so and then, the "new post" button should become visible to you.
|
posted May 28, 2013, 9:47 AM by Kathryn Johnson
I am trying to remove sequencing adaptors with Cutadapt, but I keep getting the following error: error An error occurred with this dataset:/galaxy/PRODUCTION/database/pbs/galaxy_177075.sh: line 13: cutadapt: command not found
Is this tool no longer available? If so, what tool should I use instead? |
posted May 21, 2013, 1:10 PM by Kathryn Johnson
I have several jobs (cutadapt, fastq quality trimmer) that have been waiting to run for several hours even though they are acting only on small datasets (10,000 lines). All say "job is waiting to run". This is not the first time I have run into long delays to run simple processes, but it does not happen all the time. Is there any way to avoid these delays?
|
posted May 17, 2013, 5:32 PM by David Roe
I get this error when trying to run FastqMcf:
/galaxy/PRODUCTION/database/pbs/galaxy_173983.sh: line 13: fastq-mcf: command not found
|
posted Jan 17, 2013, 3:12 PM by Paul Walker
Hello,
I have a bit of a problem. I have 100 RNA-seq, paired end, 50 cycle, ~10 million read fastq data files that I would like to
run in Tophat, Genedata Refiner Genome and then make several statistical group comparisons using Genedata Analyst.
Should I try to work through UM Galaxy in smaller batches, say 20 samples/ history ( I would run my fastq pairings in Tophat after using Fastq groomer to set the appropriate file type)? Or, would it be better to try to get help writing a script to process all the files together before moving the Tophat bam files to Genedata Refiner genome?
Previously, I have done small workflows in Galaxy and GDE of about 10 samples per history or run.
Thanks.
|
posted May 3, 2012, 5:10 PM by Tim Starr
Trying to upload file from my computer and the task just sits there saying "Job is waiting to run". Will it no longer upload when I'm at home? Do I need to be at the UM campus? |
posted Feb 28, 2012, 12:11 PM by Jerry Johnson
I am having a problem with Trinity, I think I am doing everything right. I have a single end read RNA seq library in FASTQ format, which I ran through the FASTQ groomer. When I try to run Trinity on the groomed data set, I get the following in the log: Error, cannot find meryl at /soft/trinityrnaseq/20110820/bin/trinity-plugins/kmer/meryl/meryl at /soft/trinityrnaseq/20110820/bin/Trinity.pl line 194.
And there is no data in the Assembled transcript.
It looks to me like the program can't find the place it needs to run, but I could also be missing a setting.
Thanks for any help,
Jerry
Settings:
Data is single end,
Strand specific library is F or none (neither work)
No additional parameters
Here are the first few lines of the groomed FASTQ file:
@HWI-EAS432:5:1:1:264#0/1
TGACGGAGTTGACTNCCGGGGTATCTAATCCAGTTTGCGACCTACTCTCTCATCCCTCAGTGTCATATTATCGTA
+HWI-EAS432:5:1:1:264#0/1
A=@CC>?B<@ABB:%<C@>9@13=CBBBBCBBB7BB2@;>ABA;>BBBBABBBBBB?=%3476??>???=?=399
@HWI-EAS432:5:1:1:769#0/1
TCTCCTCTCTTTCACGTTTCCGATTCGGCCGATCAATGGACGGCTTCACAGATCGGAAGAGAGGGTCAGGAGGAA
+HWI-EAS432:5:1:1:769#0/1
?;?@9?>BBBBBBB@6>BB<@1=AA?<>A@?;674?:729;;=<=='3;;7:1359/5/9/(67(0'0*%-/5,4
@HWI-EAS432:5:1:1:42#0/1
TCTCTCGGGAGCTCTTCGTCGAGGTGGAGTGGTAGACATGTACGGCTTCTTCCCCCCCCCCAAACCGGAGCCAAC
+HWI-EAS432:5:1:1:42#0/1
?B@B<B79@?<B6AA:A<<>1>??1=-:91777<7:B?8.9=;'5>7:769/9:*;='7&83;;((-0..,1-*(
@HWI-EAS432:5:1:1:1924#0/1
CTGGATTCTGAAACATTTCTCTCATTTGGGTATTTGATTCCATCATGTTACGTACATTCGGGTTCATGTTGAGCA
.
.
.
|
posted Sep 6, 2011, 11:35 AM by James Johnson
[
updated Sep 6, 2011, 1:32 PM
]
Galaxy is currently unable to queue jobs to the compute cluster. Jobs are showing the Error message: "Unable to queue job for execution." We are investigating the problem. Back in production at 3:30 PM |
posted Jul 29, 2011, 5:27 AM by Anne-Francoise Lamblin
07/29/2011 7:30AM
Galaxy may be unreachable at this time. We are experiencing a database connection problem and in the process of correcting the problem.
.
|
posted May 3, 2011, 2:52 PM by John Garbe
[
updated May 3, 2011, 3:05 PM
]
I've run into the 24 hour time limit on Galaxy jobs while running cufflinks on ~10Gb of sequence. Running the same job in the "lab" PBS queue using 12 processors took about 48 hours of walltime to finish. Could you bump up the time limit on Galaxy jobs so I can run these jobs from within Galaxy instead of downloading all the files and running the job on a different computer? =>> PBS: job killed: walltime 86421 exceeded limit 86400 |
posted Apr 18, 2011, 7:45 AM by James Johnson
[
updated May 5, 2011, 9:27 AM
]
Mothur version 1.18 was released on April 13. A significant change was implemented eliminating the read.dist, read.otu, and read.tree commands. I will be updating the Galaxy wrappers to be compataible with version 1.18. From a galaxy users perspective, the tool wrappers probably won't need to change much, since the wrappers took care of the read commands internally. However, there will be many changes required in the internal workings of the galaxy tool wrappers to match the new required parameters of many of the Mothur commands.
This would also be a good time to make usability changes to the Galaxy wrappers. If you have suggestions on what would make the Galaxy implementation of Mothur more useful to you, I'd like to hear your suggestions.
Commands get.otulist and get.sharedseqs will be added to this release. |
|
