Embedded Files
PhD student with ~72% Commonwealth Scholarship for Tuition fees at Overseas Rate ~200,000 USD for all 3 years kicked out of Plant Science department with Racist Remarks in VIVA, and supervisor published his work without his name on paper. The student earlier worked as a Scientist at Toronto, Canada, and his reference letters were from Los Alamos National Labs USA, Univ of New Mexico USA, Univ of Toronto Canada. The PhD student had potential offers from several other departments in Cambridge University, UK, itself where he could have utilized his Commonwealth Funding to continue in PhD program, and he made several rounds of appeal to University of Cambridge appeal board, but the University did not let him utilize his scholarship rejecting all the formal appeals.
"I landed my dream full 4 years Commonwealth ORS Scholarship PhD and it turned into a nightmare" - Supervisor Prof Alison G. Smith Stole PhD Proposal Ideas and Published them without crediting me - the PhD student, and co-supervisor Prof John Carr kicked me out of the lab with Racist remarks in a technically incorrectly conducted viva test. On one hand my supervisor took my project ideas in proposal and implemented it with collaborators and published it, while on other hand they told me that my ideas are un-realistic and kicked me out of PhD program, with merely a certificate of attendance. Reference letters for admission was sent from Professors at Georgia Tech, USA, and from Los Alamos National Labs, USA, and from University of Toronto, Canada. No reference letter was sent from IIT Delhi where I studied as I did not do any research work under any faculty by the time I applied for PhD program at Cambridge, UK. Yet, under the influence of IIT Delhi professors & ICGEB Delhi ex-scientist, later, Prof Alison G. Smith took away my Commonwealth funded PhD position, and there were Racist remarks by co-supervisor during Viva exam.
I, Abhishek Narain Singh, applied for PhD program at University of Cambridge at the Biochemistry department, where I was successfully offered an admit letter from Tinity Hall college but not any scholarship in 2006. Thus I did not take admission in the year 2006 when one of the reference letter was sent by Dr Shahid Jameel, ex-ICGEB Scientist. I went to work as a research scholar at University of Toronto, Canada, and asked my group leader to send a reference letter to Cambridge University UK for admission to PhD graduate program in 2007. Two more reference letters were sent from Los Alamos National Labs USA and IBM USA, where I had worked earlier. This time I was lucky as I did not just get admission after clearing the telephonic interview round, but also secured UKIERI scholarship for the entire 3 years of PhD program. I was a PhD candidate at the Department of Plant Sciences at Cambridge University, under the supervision of Prof Alison G. Smith from October 2007 to October 2008, and I was a member of Homerton College. Dr Shahid Jameel forgot that I got admission at Cambridge through his reference letter in the year 2006 when he could not help me with securing any fellowship, and on learning that I have now taken admission a year later in 2007 on a scholarship, he started all kinds of maneuvers to influence people in Cambridge University to kick me out of the full 4 years Commonwealth ORS Scholarship funded PhD program. Professors from IIT Delhi such as Prof. Dr Aditya Mittal and Prof Dr Tapan Chaudhury also assisted him, as they were not happy to see a 4 / 10 GPA student get into Cambridge purely on the basis of research work references I had earned from various places. All these insider information was shared to me by my colleagues who were also doing PhD at Cambridge Uni.
Little did I do his research on the supervisor I would be working with, in terms of her work ethics, incompatibility issues and records of past and present students! One of her student died of Cancer and another student's research work got published (stolen) by another group elsewhere from Cambridge while he was my colleague. At Cambridge, I was also elected and served as a Social & Events Director during my studies at Cambridge Graduate Student Union. My PhD project was to come up with 'strategies to increase levels of vitamin B5 in plants', as you would see the title in my report I submitted during my studies (attached link below). Prof Smith gave me articles to read from a previous PhD student Ereck Chakauya, which he had subsequently published in a year earlier than my start, in 2006. Here is the link to the article:
Attached below as inline is the email correspondences between Prof Alison Smith and myself in December 2007 along with the attachment of my project proposals with strategies to increase vitamin B5. I clearly had novel ideas that were not existing in Dr Chakuya's work before (as you can read from his work with link provided above). Prof Smith confirmed to Abhishek that if there will ever be a subsequent paper based on the ideas I have proposed, it is highly likely that I will "NOT" be the 1st or 2nd author in it, but she would ensure a co-authorship! This was strange that someone else would be given the credit as 1st author for ideas synthesized by me, but I agreed to it because of respect for previous PhD students who worked on vitamin B5 pathway understanding. Prof Smith later informed me, that a part of my ideas were also suggested by Dr Chakauya as she later told me in supervision meeting, though I was never provided with any factual background work or write-up such as any unpublished work by Dr Chakauya for those ideas in December 2007 or earlier, and it was mere verbal confidential communication between me and Prof Alison Smith, as is between a supervisor and his student. It could be fairly possible that Dr Chakauya never came up with such an idea as I had come up with as there was no such written work shown to me and Prof Alison Smith was doing favoritism, and unethical conduct in Science Research Integrity! Prof Alison Smith forced me to quote that work as Chakauya et. al. under "unpublished work" as reference in my PhD proposal (as you can see in the link). The ideas which I submitted in PhD proposal had great amount of novelty and so I had given the write-up to the patent office in Cambridge to Dr Andrew P. Walsh at Cambridge Enterprise (his email provided below), and also informed Prof Alison Smith about the same to be faithful to supervisor as should an obedient student be.
Please note that Dr Ereck Chakauya's work or that of a subsequent PhD student Dr Katy Coxon were based solely to understand the vitamin B5 pathway in plants and were Not oriented towards manipulating the pathway to increase the levels of vitamin B5. Manipulating the levels of vitamin B5 and coming up with set of strategies for the purpose was the title and content of my PhD proposal which is to be submitted within 3 months of start of PhD, and the ideas I proposed were also detailed in my 1st year report which was submitted at the 9th month of my probationary year with title 'Strategies to Increase levels of Vitamin B5'.
FINANCIAL BENEFIT FOR STUDENT TRADING, IP THEFT & RACISM
Apart from the IP theft and making money in form of grant by showing the publication to government funding body, apparently, Prof Alison G. Smith had a discussion with one of the scientist from India, Dr. Shahid Jameel, who had given a recommendation letter to Abhishek Singh for the work Abhishek carried out under him. Dr Jameel started making the allegation that I have perhaps edited the letter of recommendation that was given to me by him. Luckily, I had another reference letter from Toronto, Canada, which was sent for admission as well, so without the need to get into argumentation with Dr Jameel, I simply removed his reference letter from those that were provided for admission (the other 2 were from the US where I worked in the summers). Dr Jameel had issued me the reference letter based on the following work that I carried out & published a paper:
Abhishek Narain Singh, Dinesh Gupta and Shahid Jameel, Bioinformatics analysis of the SARS virus X1 protein shows it to be a calcium-binding protein, Current Science, Vol.86,NO.6, 25 MARCH 2004, http://tinyurl.com/sars-x1
As Abhishek had his other 2 referees from the US where he had worked in summer, and only 3 letters of references were asked for, so he did not sent a reference letter from IIT Delhi where he was doing his dual degree BTech & MTech. On getting selected to Cambridge University for PhD, some of the then junior Professors of IIT Delhi reached out to Dr Shahid Jameel and brainwashed him to change his mind. The junior Professors (then) of IIT Delhi along with Dr Shahid Jameel then contacted Prof Alison G. Smith and told her to kick him out of PhD program in exchange for India collaboration through DBT to set up an algae research centre at ICGEB (which was set up immediately). Abhishek was also threatened by Alison G. Smith's lab members to bring the top ranker to Cambridge in the lab or else he will be kicked out from PhD. Clearly, this meant that Prof Alison Smith got into some kind of collaborative agreement from Indian Professors, in exchange for kicking him out of PhD program.
Much of this information of ICGEB / Indian scientists involved in this politics was leaked out and informed to Abhishek through various sources at Cambridge itself. This was also further confirmed to Abhishek upon his return to India, when Dr. Shahid Jameel tells him that 'We did all this to teach you a lesson. I am part of the IIT Network too as I have an MSc from IIT. You also know who those Professors are from IIT Delhi - No Violence.´ While Abhishek was suggested to not do crime, allegedly his father was killed by drug overdose poisoning when he was working in Finland and could not come to India due to Covid-19 lockdown (court case ongoing). The Finland employers also confirmed to Abhishek that IIT Delhi and Cambridge Professors are after him, in one of the meetings. The IIT Delhi Professors also confirmed Abhishek that they had a meeting with Cambridge Professor and in which Dr Jameel had told them that 'It is a HUuUuGE mistake. This guy tells Biotech is the same as testicles ( in reference to a spat Abhishek had with his batchmate who did not make it to any University for PhD despite having a good rank ) . We will set up a research collaboration for you in India. Thank you your Majesty.'
Are these Professors not answerable to funding bodies such as Commonwealth who had given Abhishek a complete 3 years of ORS Equivalent 70% scholarship, out of which only 1 academic year was utilized, and despite having funding for remaining 2 years, Abhishek was not allowed to go back to his previous department of Biochemistry or any other department where there were other scientists willing to onboard him to his group ?!? Or will the professors continue to trade their PhD students for personal gains without any check from University & Government of Funding body to which Abhishek had made 3 rounds of appeals while he was still living in Cambridge city ?
This work got referenced by another publication by Prof Smith in which she was the last author as well in a book chapter:
Ereck Chakauya, Katy Coxon, et al., Towards engineering increased pantothenate (vitamin B5) levels in plants, Plant Molecular Biology, November 2008, Volume 68, Issue 4–5, pp 493–503, PMID: 18726075 DOI: 10.1007/s11103-008-9386-5 , https://link.springer.com/content/pdf/10.1007%2Fs11103-008-9386-5.pdf
Here is the publication and the URL link:
Apparently, as soon as I submitted my proposal to Prof Smith in December 2007, Prof Alison Smith submitted a draft version of the manuscript for publication to Springer Nature journal 'Plant Molecular Biology', and she did not include me even as a co-author, despite the fact that it was her student i.e. me who worked on coming up with the ideas, as you can clearly see in my project proposal as evidence. Prof Smith had approved the project proposal as she called me to her office to get a printed version of the same for her signature (her email correspondences also provided below). A revised version of the manuscript was submitted by Prof Smith to journal which was accepted in July 31st 2008 and later published within a month in August 23rd 2008, much when I was still officially a University of Cambridge student and in that case without my name being written anywhere, despite all the ideas that were published by Prof Smith were those suggested by me!!
I was being prevented to continue as a PhD student despite my repeated appeal, and complaint against racist & improper conduct of viva exam by Dr Carr, and my ideas which were considered not good for continuing as a PhD student were stolen by my supervisor and published on her name, almost immediately after I was literally kicked out from the group, getting insulted in front of rest of the group members. I had requested Prof Smith to keep the ideas synthesized by me in PhD proposal confidential as I did not want to waste the intellectual property aspect of the invention by merely just publishing the work as a journal article, when the manipulation strategy for vitamin B5 were clearly a patentable idea, and I had timely and honestly approached the right office within Cambridge University for the purpose.
Threat to kick out of PhD program if you do not bring your class topper to the group.
After having spend close to 6 months in the PhD program in Alison Smith's group, they had a strange demand for me. They wanted me to contact my batch topper from IIT Delhi and ask her to join the group. Previously, she had applied for a PhD position at Cambridge, and was not selected, while I got selected. So they demanded me to contact her and request her to join the group or else I would loose my PhD (and so it happened), as I was on probation.
There was a viva exam conducted which was without any external examiner - a faulty oral test, where questions all not related to topic of my research on vitamin B5 pathway were asked. Dr John Carr, my co-supervisor who conducted the viva, was so much disappointed by me in the viva exam that he even used indirect racist remarks , "I know where you are coming from, I know what your background is, I know what your roots are", implying that he was pointing to my country of origin - India, a former British colony for which I believe given bitter experiences of history of England and India, any Britisher should be very very careful about saying something about the roots of an Indian who is professionally engaged with him, especially when he is holding the post of a Professor at Cambridge and is more than 60 years of age! Dr Carr, dismissed all my ideas for producing transgenic plants with increased vitamin B5 content, knowing or unknowing that those same ideas which were proposed by me were about to get published by my supervisor Prof Alison Smith. Dr Michael Moulin (Post Doc) in Prof Smith's group, came running to me after viva and says sarcastically "How did the viva exam go? I know you are 1st trying to get an M.Phil. ! " - in other words he had planned all of this along with Prof Smith! Previously, Dr Moulin had suggested me during lunch hour that your Viva exam would be made tough. I was told in my first year viva examination that my report is unfit for novelty of ideas and so I would not be allowed to continue in PhD program. Dr Carr stated about the roots of my in India, because some professional rival professors in India who were unhappy to see me get into Cambridge University, had made contacts with him and Prof Alison G. Smith and made up a fake story that he has criminal records and is a terrorist! It was strange that the UK Porfessors believed them directly without even noticing that I have had sevearal US /Canada/UK and Shengen visa already and if I was a terrorist I would not have been successful getting the visa on the first place.
Webb ME; Smith AG (2011) Pantothenate Biosynthesis in Higher Plants. BIOSYNTHESIS OF VITAMINS IN PLANTS: VITAMINS A, B1, B2, B3, B5, PT A, 58 , pp. 203-255.
1. Plagiarised my PhD proposal idea(s), where a student keeps utmost trust in sharing research secrets with his supervisor
2. Lead to Loss of potential financial gains by commercializing the patent that would have been clearly granted
3. Prof Smith got engaged in personal gains by using the publication as a means to apply for research grants to advance the work, ensuring that I cannot do the same in any new lab that I would have joined. She also gained financial benefits by collaborating the research work with company, by selling the ideas to Biogemma and likely others too!
4. Put my career to halt as I had nothing productive to show what I did while in Cambridge. Without a degree from UK such as even an M.Phil, it was not possible to get a job! I lost at least 3 years in total and had to move in a research career different than plant biochemistry.
5. Loss of 2 remaining years of Commonwealth funding as Prof Smith ensured that I would not be admitted to any other labs in the University as a transfer PhD student, even though many scientists from other Biological & Medical science departments were interested in having me.
By publishing the work and not putting my name as a co-author Prof Smith:
'"Ideas are worth a dime" is a popular quote that is being used to reduce the importance of idea and give more value to the implementer. Though I believe that this makes pure sense in business and practical world, should that be the case as well for academic world for PhD research students, where the student is suppose to honestly report all plans to his supervisor? I shall not agree that the supervisor has the right to implement the ideas after the student has left his group; and the current case is worse since the student is still working in her lab, that she outsources the cheap labor work of implementation of the idea to collaborators in academia and also commercializing it with partner company Biogemma (Biogemma Ltd., Cambridge Science Park, Cambridge, UK) !? Dr Chakauya (1st and corresponding author) had for instance left Prof' Smith's lab by more than 1.5 years and was working in S. Africa as a project manager! '
Modified Monod Model Discontinuation
Abhishek had done some improvements in Monod model for cell growth which needed some more improvements. He was forced to run a centrifuge using glassware tube which broke inside the centrifuge. From his experience, Abhishek had clearly stated that glass should not be used in the centrifuge, but the lab seniors did not listen to him. The interim mathematical work on modified Monod kinetics work was also stopped, and no action was taken on lab members who forced Abhishek to use glass tube in centrifuge machine. Now, everyone knows that Monod model of cell growth is not near to perfection and has a lot of flaws. Instead of encouring him to work on improvising the model, his PhD was shut down due to influence from IIT/ ICGEB Delhi rivals, despite having Commonwealth fellowship for the entire 3 years duration of PhD.
PhD Project Proposal:
Year of occurence of Racism - 2008; Organizations Abhishek Approached to Report Racism immediately:
Cambridge University Student Union(CUSU), Complaint Stages Cambridge University, Constabulary (Incident number: CC-07062008-0506), County Civil court (Case Number: 9CB01366), England Helpline Equality Human Rights (reference: 1-7391242), Office of the Independent Adjudicator (Reference: OIA/08137/09)
Abhishek Narain Singh
------
Year of Realization of Plagiarism - 2018; Organizations Abhishek Approached to Report Plagiarism immediately:
Dr Ereck Chakauya (1st and corresponding author of the paper), Springer Nature Editor of the journal, Cambridge University Research Integrity office, Ministry of External Affairs Education Wing (sspol.london@mea.gov.in), The Cambridge Student (Press), Cambridge IP office (case number is Sin-2195-08), Office of the Independent Adjudicator (Reference OIA/622345/18), Biogemma Ltd. (Cambridge).
Prof Alison Smith's webpage: https://www.plantsci.cam.ac.uk/directory/smith-alison
Prof John Carr's webpage: https://www.plantsci.cam.ac.uk/directory/carr-john
Dr Kaushik Saha's webpage: https://profiles.ucsd.edu/kaushik.saha
If Prof Smith had personality clashes with me or there were problems with me getting along with any member of her group, in that case she should have simply facilitated the transfer of my PhD to another group, for which I myself had later made several request to the University directly and through my graduate tutor at Homerton college, Dr Penny Barton.However Dr Barton could not be of much help as Prof Smith came to me while I was in department library to say "I have a PhD and M.Phil., and I will make sure that you will not get a PhD or even M.Phil. All the scholarship money you have from the people of Commonwealth countries will get wasted". Prof Alison G. Smith chose to steal my work and immediately publish it before I was even de-registered from the student database, and keep the publication secret and hidden as she did not mention about it on her Cambridge Plant Sciences webpage. She sends her final year student Dr Kaushik Saha to me who tells me "We are digging nails to your coffin now"! No wonder,even though I had several PhD positions offerend in Cambridge University itself and that I had Commonwealth Scholarship which as for 70% in 2025 would account for about GBP 120,000 (1 Crore 30 Lacs INR) for 3 years, these forces never let me continue for the PhD!
Cambridge Intellectual Property officer Dr Andrew Walsh wrote to me and Prof Alison Smith about the potential patent application on 30th July 2008, and apparently on the same date Prof Smith submits the final version of the research paper on it for publication, and that too without my name for the ideas I gave her in my PhD proposal (Email proof provided below)!
*********************************************
Professor Alison Smith
Department of Plant Sciences
University of Cambridge
Downing Street
Cambridge CB2 3EA
UK
Tel: (+44)-1223-333952
Fax: (+44)-1223-333953
http://www.plantsci.cam.ac.uk/Smith/Index.html
Emails with Dr Chakauya start only in 2008 (while the PhD proposal ideas were given in 2007 alrady):
---------- Forwarded message ---------
From: Ereck Chakauya <EChakauya@csir.co.za>
Date: Wed, Feb 27, 2008 at 12:35 PM
Subject: Re: pGEE Sequence
To: A.N. Singh <ans47@cam.ac.uk>
Dear Narain
Thanks for being in touch. My apologise for replying late I don't normally do that. Anyway, the primer EER2 should work although it only amplifies only 3 quarters of it. I am not sure the CaMV primer seems not to work. I suggest you try this one from Herald: CaMV35Sf2 (Anneals 15bp before conserved TATA box sequence from the Cauliflower Mosaic virus 35S promoter. Used to confirm the presence of constructs under the control of the 35S promoter. Tm 58.9C). Sequence: TGACGCACAATCCCACTATCCTTC. I have attached the alignments for the two primers to the respective genes. Otherwise I can't find the pGEE plasmid but the CaMV35SS promoter I have used for the alignment is the the same cassette in the pGEE binary vector. If you need anything else give me a shout.
Good luck
Dr Ereck Chakauya
Senior Scientist
CSIR Biosciences
Building 20 Meiring Naude
P O Box 395
Pretoria 0001
South Africa
Tel: 0128413837
Fax:0128413651
>>> "A.N. Singh" <ans47@cam.ac.uk> 26/02/2008 13:31 >>>
Dear Dr Ereck
I am a PhD candidate under the supervision of Prof. Alison Smith. I am
continuing the research on pantothenate, in which you were involved at some
time in our lab. Currently, I am facing difficulty with getting the
positive control working as I am not getting any band using the primers
mentioned in your thesis. The primers that I am using to EEamplify E. coli
panE gene are:
CaMV35Sf2 cgcacaatcccactatcctt
EEr2 atagtcgatttcggtgtggc
I was wondering if it was possible for you to send me the sequence of pGEE
vector.
Sincerely
Narain
*********
Email to Dr Ereck Chakauya in 2018:
-------------------------------------------------
---------- Forwarded message ---------
From: Abhishek Narain Singh <abhishek.narain@iitdalumni.com>
Date: Sat, Dec 15, 2018 at 2:23 AM
Subject: Re: Authorship Inclusion Request: Former PhD student of Cambridge University
To: <echakauya@csir.co.za>
Dear Dr Chakauya
In the beginning of this year in Feb 2018, I informed you about plagiarism of a scientific work by my PhD supervisor at Cambridge University, for which you are the corresponding author! Here is the link to the publication: https://link.springer.com/content/pdf/10.1007%2Fs11103-008-9386-5.pdf Towards engineering increased pantothenate (vitamin B5) levels in plants .
Below is the email once again attached as inline.
Can you please let me know if you intend to make the correction to the paper the paper and put me as a co-author, if not the lead author, since the ideas were proposed by me, as is the proof by PhD proposal that I submitted (attached again) , and later also submitted as my 1st year report (attached as M.Phil report).
Cambridge Intellectual Property office wrote to me and Prof Alison Smith about the potential patent application on 30th July 2008, and apparently on the same date Prof Smith submits the final version of the research paper on it for publication!
---------- Forwarded message ---------
From: Andrew P. Walsh <Andrew.Walsh@enterprise.cam.ac.uk>
Date: Wed, Jul 30, 2008 at 9:06 PM
Subject: Invention Disclosure
To: Narain <abhishek.bhadoria@gmail.com>
Cc: <as25@cam.ac.uk>
Dear Narain,
Thank you for your invention disclosure relating to the changing the localisation of enzymes within the cell in order to evade product inhibition and hence increase the yield of desirable products.
I have opened a file on this disclosure so that we have a record of it (the relevant case number is Sin-2195-08). However, I can confirm that, as I mentioned to you when we met, that my view is that this idea is a too early a stage for Cambridge Enterprise to take it on. Although you have come up with an approach that would appear to be novel and inventive, you have yet to be able to demonstrate that it works.
I suggest that if you wish to take this idea forward and at a later date you should get back in touch with Cambridge Enterprise if it becomes necessary to obtain a statement from us that we do not have any claim to IP that you are seeking to protect or develop commercially. We would then look at the funding situation and investigate if there are other members of the lab who may be co-inventors.
I have copied your supervisor, Prof. Smith into this email so that she is aware of the discussions that we have had and Cambridge Enterprise’s decision.
Best wishes
Andy.
Andrew Walsh Ph.D, Technology Manager
Cambridge Enterprise Limited, University of Cambridge, 10 Trumpington Street, Cambridge, CB2 1QA, UK
Tel: +44 (0)1223 760339 Direct: +44 (0)1223 760338 Fax: +44 (0)1223 764888
Email: andrew.walsh@enterprise.cam.ac.uk Web: www.enterprise.cam.ac.uk
Cambridge Enterprise Limited is a wholly owned subsidiary of the University of Cambridge. It is responsible for the commercialisation of technology arising from the University's Departments. Activities include patents, licences, company start-ups and consultancy agreements for academics wishing to undertake external work. There are a number of annual events held to link commercialisation activities with industry.
Cambridge Enterprise Limited is registered in England and Wales. Company Number: 1069886. Registered office: The Old Schools, Trinity Lane, Cambridge CB2 1TN.
The information contained in this communication and in any attachment to it, is confidential and may be privileged. If you have received this communication in error please contact the sender, delete all electronic copies and destroy any hard copies. Thank you.
Emails with Prof Alison Smith:
---------- Forwarded message ----------
From: A.N. Singh <ans47@cam.ac.uk>
Date: Mon, Dec 17, 2007 at 12:51 PM
Subject: Re: Project Proposal Draft
To: Alison Smith <as25@cam.ac.uk>
Cc: abhishek.bhadoria@gmail.com
Respected Madam
Attached is the draft for project proposal.
Sincerely
Narain
*********
---------- Forwarded message ----------
From: Alison Smith <as25@cam.ac.uk>
Date: Tue, Dec 18, 2007 at 4:42 PM
Subject: Re: Project Proposal Draft
To: "A.N. Singh" <ans47@cam.ac.uk>
Cc: Linda Linsley <lml22@cam.ac.uk>
Dear Narain
Can you bring a hard copy of your project proposal into the lab for me to sign - I am only here today, then away until after Christmas. If we miss each other, take the hard copy to Linda Linsley and I confirm in this email that I approve it. I have asked John Carr to be your second supervisor, and he will get back to Linda within the next day or so about this.
best wishes
Alison
On 17 Dec 2007, at 11:51, A.N. Singh wrote:
Respected Madam
Attached is the draft for project proposal.
Sincerely
Narain
<PhD Project Proposal.doc>
https://docs.google.com/document/d/1U8nCCUQWZrGl3cHKVAMRTAPqvnnO4hwC7ZVQdp6AYF4/edit?usp=sharing
PhD 1st Year report:
https://drive.google.com/file/d/19OR1zbiLvXAIJM1vkxNdKOKENhwSDw0p/view?usp=sharing
Technical details about the Genetic Engineering of the vitamin B5 Pathway proposed by Abhishek:
Enzyme KPHMT was suggested to be expressed in the cytosol by me due to several regulation steps that were there in mitochondria where KPHMT1 and KPHMT2 was known to be expressed in plants, and also since there would be regulation for the transporters of KPHMT based reaction components itself into and out of the mitochondrial sub-cellular compartment, which clearly can be by-passed by ensuring that this biochemical reaction occurs outside the mitochondria in the cytosol of the cell. This idea was NOT proposed by Dr Chakauya or Dr Coxon as you can see in his work from the previous link that is provided above, and it was Abhishek's novel idea which was part of PhD project proposal.
Dr Chakauya had long left Cambridge University, since more than a year , and was physically based in South Africa. While Dr Coxon was still in Plant Sciences department writing her thesis, at no point does Abhishek recall her of discussing with him any molecular biology strategic manipulation of the biochemical pathway that could have lead to increase in vitamin B5 pathway, as her focus of studies was to understand the pathway and not manipulate the pathway. Here is the publication by Dr Coxon:
K.M. Coxon et al., Pantothenate biosynthesis in higher plants, Biochemical Society Transactions (2005) Volume 33, part 4.
Abhishek has also reached out to the editor of the journal, who has promised all co-operation to investigate the details of the case, such as who was the submitting author, the co-authors in the beginning of the submission, and the contents of the paper on January 30th and how these changed over the time until the paper finally got published on 23rd August 2008. However, Cambridge University is stopping the Journal from releasing these details.
While Prof Alison G. Smith suggested that Abhishek can take his ideas and continue in PhD elsewhere, she also made sure that she would secretly steal Abhishek's PhD work as she published his ideas and plagiarized them, or at least make sure that she is getting those ideas on vitamin B5 overproduction being implemented by other collaborators outside Cambridge in parallel, while ethically she is NOT suppose to give project to someone else at the same time when her PhD student is working on it as well.
Email Exchanges with Springer Nature journal to release details of publications, which he is not willing to:
---------- Forwarded message ---------
From: Flipsen, Jacco, Springer SBM NL <Jacco.Flipsen@springer.com>
Date: Wed, Apr 11, 2018 at 5:02 PM
Subject: RE: Authorship Concerns: Supervisor Stealing Ideas & Publishing
To: aby.narain@gmail.com <aby.narain@gmail.com>
Dear Mr. Singh,
I have consulted with the Springer Nature Research Integrity Group, and I am writing to you that it is not possible to share the initial submission and follow up details with you as it would be a breach of the confidentiality of the peer review process. As I have mentioned earlier, Springer is not a party in the discussion, and you need to resolve the matter with the University.
I trust you understand our position in this.
Kind regards,
Jacco Flipsen
---------- Forwarded message ---------
From: Education Wing <education.wing@hcilondon.in>
Date: Tue, Dec 18, 2018 at 10:30 PM
Subject: Abhishek - Kindly take up the matter with the University.
To: <abhishek.narain@iitdalumni.com>
Cc: Aseem Vohra <sspol.london@mea.gov.in>
Dear Abhishek,
We have noted your complaint. You are advised to take up the matter with appropriate authorities in your University.
Best regards,
Valli NagappanEducation WingHigh Commission of IndiaAldwych, LondonWC2B 4NAPh: +44 2076323063Email: education.wing@hcilondon.inFollow us: https://www.hcilondon.in/index.phphttps://www.facebook.com/IndiaInUK/https://twitter.com/HCI_London
Incident at University of Virginia, USA:
After having left Cambridge Uni, I was working at University of Virginia, UVa, as a Research Scientist. Prof Alison Smith informed Dr Jayakrishna Ambati, that I was fired from PhD program because of 'academic incompetence'. Webpage of Dr Ambati: https://med.virginia.edu/faculty/faculty-listing/ja9qr/
Email with Education wing Ministry of External Affairs:
From: Abhishek Narain Singh [mailto:abhishek.narain@iitdalumni.com]
Sent: Friday, April 06, 2018 10:19 AM
To: aby.narain; Flipsen, Jacco, Springer SBM NL
Cc: onlineserviceSAP
Subject: Re: Authorship Concerns: Supervisor Stealing Ideas & Publishing
Dear Dr Flipsen
Hope you are doing well. The University of Cambridge is not willing to collaborate with me in sorting out the issues related to plagiarism. Thus I would like to make a humble appeal to you once again to give me a copy of the 1st submission of the article I requested and the details of follow-up. I would now have to settle this issue via legal means. Your co-operation is very crucial. Let me know if you would like me to call you or visit you. I am based in Heidelberg.
Here is the link to the publication: https://link.springer.com/content/pdf/10.1007%2Fs11103-008-9386-5.pdf
Towards engineering increased pantothenate (vitamin B5) levels in plants .
Towards engineering increased pantothenate (vitamin B5) levels in plants .
Expecting a supportive reply,
Kind regards,
Abhishek
Email to Biogemma Company Ltd.:
From: Abhishek Narain Singh <abhishek.narain@iitdalumni.com>
Date: Fri, Jan 4, 2019 at 12:07 PM
Subject: Plagiarism on a paper by you Vitamin B5
To: <info-biogemma@biogemma.com>
Cc: aby.narain <aby.narain@gmail.com>
Dear Sir / Madam
One of the papers you published is plagiarized from my PhD thesis proposal. Would you like to do needful corrections and remedy please ?
Ereck Chakauya, Katy Coxon, et al., Towards engineering increased pantothenate (vitamin B5) levels in plants, Plant Molecular Biology, November 2008, Volume 68, Issue 4–5, pp 493–503,
PMID:18726075DOI: 10.1007/s11103-008-9386-5 ,
https://link.springer.com/content/pdf/10.1007%2Fs11103-008-9386-5.pdf
The details of complete case is here www.tinyurl.com/cambridgecase .
Abhishek Narain Singh
Project DEMA : https://cordis.europa.eu/project/id/309086
As part of PhD program at Cambridge, Abhishek had participated in iGEM 2008 organized at Cambridge in which his group won the 1st prize. He had given the proposal that we can directly produce alcohol (ethanol) from algae. He shared this idea with his supervisor as well. His supervisor kicked him out of the lab, and then wrote a grant to EU to get close to 6.5 Million Euros funding - the project lasted for 5 years. It is strange that while the ideas given by Abhishek were simply stolen by Cambridge University, there were fabricated reasons to tell him that your ideas are not worth.
Incident with Centrifuge:
In his M.Tech, Abhishek had operated centrifuges and other equipment and he knew that the glass tubes needs holder before inserting to centrifuge. His colleagues (Dr Moulin PostDoc) advised Dr Keith Macaulay to tell me to run centrifuge without the holder. They being seniors in the lab, Abhishek had to listen to their orders and as a result there was an accident in the lab as the glass tubes collapsed in the centrifuge. The blame game started and the fingers were pointing to Abhishek.
County Court Case against Homerton College for breach of tenancy agreement with just 24 hours notice period and fellow students for instigating the matter
Page updated
Report abuse